Mutagenetix > Incidental Mutations

Incidental Mutation 'R9011:Serpinb13'

685610

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R9011 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106995789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 75 (I75V)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably benign
Transcript: ENSMUST00000027564
AA Change: I75V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I75V

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

silent
Transcript: ENSMUST00000136766

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	A	T	18: 57,667,304	I176F	possibly damaging	Het
Actr10	A	G	12: 70,952,960	T177A	probably benign	Het
Adgrb2	G	A	4: 130,022,318	D1468N	probably damaging	Het
AF067061	A	G	13: 120,264,210	T137A	probably damaging	Het
Aldh16a1	A	G	7: 45,145,527	F506S	probably damaging	Het
Ankfn1	A	T	11: 89,526,618	M56K	probably benign	Het
Atxn7l2	T	C	3: 108,207,440	S97G	probably benign	Het
Cacna1g	C	T	11: 94,415,837	G1905D	probably benign	Het
Ccne1	A	T	7: 38,106,660	M13K	probably benign	Het
Chil3	A	T	3: 106,149,715	Y304*	probably null	Het
Chst15	A	G	7: 132,270,517	F12L	probably benign	Het
Cldn23	T	A	8: 35,825,672	I221F	probably damaging	Het
Col16a1	T	C	4: 130,052,859	F92L	unknown	Het
Cyp2w1	T	A	5: 139,354,559	V199E	possibly damaging	Het
Dmxl1	A	G	18: 49,864,173	Y512C	probably damaging	Het
Dopey1	A	T	9: 86,515,343	H900L	probably damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Eif3l	T	G	15: 79,089,525	M380R	possibly damaging	Het
Fam71a	A	C	1: 191,163,061	S462A	probably benign	Het
Fer1l5	A	T	1: 36,402,520	K605N	probably damaging	Het
Fgfbp1	T	G	5: 43,979,285	N222H	probably benign	Het
Flcn	A	G	11: 59,799,407	L273P	possibly damaging	Het
Fzd10	C	G	5: 128,602,305	P363R	probably damaging	Het
Gfi1	A	G	5: 107,725,559		probably null	Het
Ift57	A	G	16: 49,759,414	Q316R	probably benign	Het
Itga11	T	C	9: 62,755,627	F542L	probably benign	Het
Kif28	G	C	1: 179,702,419	L726V	possibly damaging	Het
Krt90	A	G	15: 101,562,800	I9T	probably benign	Het
Lefty1	A	T	1: 180,937,676	M270L	probably benign	Het
Mipol1	A	T	12: 57,457,079	E344D	probably benign	Het
Mon2	A	T	10: 123,026,308	M737K	possibly damaging	Het
Mrpl14	A	G	17: 45,698,404	N143S	probably benign	Het
Nelfcd	T	A	2: 174,426,924	H589Q	probably benign	Het
Npepps	T	C	11: 97,240,931	M366V	probably damaging	Het
Olfr1448	A	T	19: 12,920,115	S65T	probably damaging	Het
Platr25	T	A	13: 62,700,466	H194L	probably damaging	Het
Plekhg4	T	C	8: 105,375,652	I127T	probably benign	Het
Rarb	A	G	14: 16,435,140	V302A	probably damaging	Het
Rc3h1	A	C	1: 160,965,103	T1037P	probably damaging	Het
Rnaset2a	G	A	17: 8,137,928	P102S	probably damaging	Het
Scn10a	A	C	9: 119,630,094	S1166R	probably damaging	Het
Scn3a	A	G	2: 65,521,826	M380T	possibly damaging	Het
Slc35f5	G	A	1: 125,562,313	A27T	probably benign	Het
Slc45a3	G	A	1: 131,977,976	V246I	probably benign	Het
Slc7a14	G	A	3: 31,224,196	T420I	probably damaging	Het
Slc9a9	A	G	9: 94,936,440	T296A	probably benign	Het
Smyd2	G	A	1: 189,896,636	H157Y	probably damaging	Het
Spata32	T	A	11: 103,209,851	H30L	probably benign	Het
Srarp	T	C	4: 141,433,033	E163G	possibly damaging	Het
Tmed8	A	G	12: 87,174,164	I216T	probably damaging	Het
Tnni3k	A	T	3: 154,856,549	L697Q	probably damaging	Het
Tra2b	G	A	16: 22,247,190	R286C	unknown	Het
Trav7-6	A	G	14: 53,717,147	K65E	probably benign	Het
Ttn	T	C	2: 76,710,162	D34160G	possibly damaging	Het
Umad1	T	A	6: 8,373,931	C36*	probably null	Het
Ush2a	A	T	1: 188,906,479	T4029S	probably damaging	Het
Usp9y	C	T	Y: 1,316,978	S1857N	probably benign	Het
Vwa3b	A	G	1: 37,115,686	N517S	probably damaging	Het
Zfp583	G	A	7: 6,316,628	P462S	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGCATCTGACTTGGCAGAAAG -3'
(R):5'- GAAATAGTCCCATGGCAAGCAG -3'

Sequencing Primer
(F):5'- CTTGGCAGAAAGTCAAATGGC -3'
(R):5'- CAGGGATACTGGCCATTTCTTG -3'

Posted On

2021-10-11