Incidental Mutation 'R9011:Serpinb13'
ID 685610
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106995789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 75 (I75V)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably benign
Transcript: ENSMUST00000027564
AA Change: I75V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I75V

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect silent
Transcript: ENSMUST00000136766
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,304 I176F possibly damaging Het
Actr10 A G 12: 70,952,960 T177A probably benign Het
Adgrb2 G A 4: 130,022,318 D1468N probably damaging Het
AF067061 A G 13: 120,264,210 T137A probably damaging Het
Aldh16a1 A G 7: 45,145,527 F506S probably damaging Het
Ankfn1 A T 11: 89,526,618 M56K probably benign Het
Atxn7l2 T C 3: 108,207,440 S97G probably benign Het
Cacna1g C T 11: 94,415,837 G1905D probably benign Het
Ccne1 A T 7: 38,106,660 M13K probably benign Het
Chil3 A T 3: 106,149,715 Y304* probably null Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Cldn23 T A 8: 35,825,672 I221F probably damaging Het
Col16a1 T C 4: 130,052,859 F92L unknown Het
Cyp2w1 T A 5: 139,354,559 V199E possibly damaging Het
Dmxl1 A G 18: 49,864,173 Y512C probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif3l T G 15: 79,089,525 M380R possibly damaging Het
Fam71a A C 1: 191,163,061 S462A probably benign Het
Fer1l5 A T 1: 36,402,520 K605N probably damaging Het
Fgfbp1 T G 5: 43,979,285 N222H probably benign Het
Flcn A G 11: 59,799,407 L273P possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gfi1 A G 5: 107,725,559 probably null Het
Ift57 A G 16: 49,759,414 Q316R probably benign Het
Itga11 T C 9: 62,755,627 F542L probably benign Het
Kif28 G C 1: 179,702,419 L726V possibly damaging Het
Krt90 A G 15: 101,562,800 I9T probably benign Het
Lefty1 A T 1: 180,937,676 M270L probably benign Het
Mipol1 A T 12: 57,457,079 E344D probably benign Het
Mon2 A T 10: 123,026,308 M737K possibly damaging Het
Mrpl14 A G 17: 45,698,404 N143S probably benign Het
Nelfcd T A 2: 174,426,924 H589Q probably benign Het
Npepps T C 11: 97,240,931 M366V probably damaging Het
Olfr1448 A T 19: 12,920,115 S65T probably damaging Het
Platr25 T A 13: 62,700,466 H194L probably damaging Het
Plekhg4 T C 8: 105,375,652 I127T probably benign Het
Rarb A G 14: 16,435,140 V302A probably damaging Het
Rc3h1 A C 1: 160,965,103 T1037P probably damaging Het
Rnaset2a G A 17: 8,137,928 P102S probably damaging Het
Scn10a A C 9: 119,630,094 S1166R probably damaging Het
Scn3a A G 2: 65,521,826 M380T possibly damaging Het
Slc35f5 G A 1: 125,562,313 A27T probably benign Het
Slc45a3 G A 1: 131,977,976 V246I probably benign Het
Slc7a14 G A 3: 31,224,196 T420I probably damaging Het
Slc9a9 A G 9: 94,936,440 T296A probably benign Het
Smyd2 G A 1: 189,896,636 H157Y probably damaging Het
Spata32 T A 11: 103,209,851 H30L probably benign Het
Srarp T C 4: 141,433,033 E163G possibly damaging Het
Tmed8 A G 12: 87,174,164 I216T probably damaging Het
Tnni3k A T 3: 154,856,549 L697Q probably damaging Het
Tra2b G A 16: 22,247,190 R286C unknown Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Ttn T C 2: 76,710,162 D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 C36* probably null Het
Ush2a A T 1: 188,906,479 T4029S probably damaging Het
Usp9y C T Y: 1,316,978 S1857N probably benign Het
Vwa3b A G 1: 37,115,686 N517S probably damaging Het
Zfp583 G A 7: 6,316,628 P462S probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCATCTGACTTGGCAGAAAG -3'
(R):5'- GAAATAGTCCCATGGCAAGCAG -3'

Sequencing Primer
(F):5'- CTTGGCAGAAAGTCAAATGGC -3'
(R):5'- CAGGGATACTGGCCATTTCTTG -3'
Posted On 2021-10-11