Incidental Mutation 'R9011:Serpinb13'
ID 685610
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HUR7, HURPIN, PI13, headpin
MMRRC Submission 068841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 106908714-106928925 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106923519 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 75 (I75V)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably benign
Transcript: ENSMUST00000027564
AA Change: I75V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I75V

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect silent
Transcript: ENSMUST00000136766
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,999,734 (GRCm39) T177A probably benign Het
Adgrb2 G A 4: 129,916,111 (GRCm39) D1468N probably damaging Het
Aldh16a1 A G 7: 44,794,951 (GRCm39) F506S probably damaging Het
Ankfn1 A T 11: 89,417,444 (GRCm39) M56K probably benign Het
Atxn7l2 T C 3: 108,114,756 (GRCm39) S97G probably benign Het
Cacna1g C T 11: 94,306,663 (GRCm39) G1905D probably benign Het
Ccdc192 A T 18: 57,800,376 (GRCm39) I176F possibly damaging Het
Ccne1 A T 7: 37,806,085 (GRCm39) M13K probably benign Het
Chil3 A T 3: 106,057,031 (GRCm39) Y304* probably null Het
Chst15 A G 7: 131,872,246 (GRCm39) F12L probably benign Het
Cldn23 T A 8: 36,292,826 (GRCm39) I221F probably damaging Het
Col16a1 T C 4: 129,946,652 (GRCm39) F92L unknown Het
Col6a3 A T 1: 90,710,057 (GRCm39) probably benign Het
Cyp2w1 T A 5: 139,340,314 (GRCm39) V199E possibly damaging Het
Dmxl1 A G 18: 49,997,240 (GRCm39) Y512C probably damaging Het
Dop1a A T 9: 86,397,396 (GRCm39) H900L probably damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Eif3l T G 15: 78,973,725 (GRCm39) M380R possibly damaging Het
Fer1l5 A T 1: 36,441,601 (GRCm39) K605N probably damaging Het
Fgfbp1 T G 5: 44,136,627 (GRCm39) N222H probably benign Het
Flcn A G 11: 59,690,233 (GRCm39) L273P possibly damaging Het
Fzd10 C G 5: 128,679,369 (GRCm39) P363R probably damaging Het
Gabpa A G 16: 84,638,209 (GRCm39) probably benign Het
Garin4 A C 1: 190,895,258 (GRCm39) S462A probably benign Het
Gfi1 A G 5: 107,873,425 (GRCm39) probably null Het
Ift57 A G 16: 49,579,777 (GRCm39) Q316R probably benign Het
Itga11 T C 9: 62,662,909 (GRCm39) F542L probably benign Het
Kif28 G C 1: 179,529,984 (GRCm39) L726V possibly damaging Het
Krt90 A G 15: 101,471,235 (GRCm39) I9T probably benign Het
Lefty1 A T 1: 180,765,241 (GRCm39) M270L probably benign Het
Mipol1 A T 12: 57,503,865 (GRCm39) E344D probably benign Het
Mon2 A T 10: 122,862,213 (GRCm39) M737K possibly damaging Het
Mrpl14 A G 17: 46,009,330 (GRCm39) N143S probably benign Het
Nelfcd T A 2: 174,268,717 (GRCm39) H589Q probably benign Het
Npepps T C 11: 97,131,757 (GRCm39) M366V probably damaging Het
Or5b12 A T 19: 12,897,479 (GRCm39) S65T probably damaging Het
Platr25 T A 13: 62,848,280 (GRCm39) H194L probably damaging Het
Plekhg4 T C 8: 106,102,284 (GRCm39) I127T probably benign Het
Ralgapa1 A T 12: 55,652,314 (GRCm39) probably benign Het
Rarb A G 14: 16,435,140 (GRCm38) V302A probably damaging Het
Rc3h1 A C 1: 160,792,673 (GRCm39) T1037P probably damaging Het
Rnaset2a G A 17: 8,356,760 (GRCm39) P102S probably damaging Het
Scn10a A C 9: 119,459,160 (GRCm39) S1166R probably damaging Het
Scn3a A G 2: 65,352,170 (GRCm39) M380T possibly damaging Het
Slc35f5 G A 1: 125,490,050 (GRCm39) A27T probably benign Het
Slc45a3 G A 1: 131,905,714 (GRCm39) V246I probably benign Het
Slc7a14 G A 3: 31,278,345 (GRCm39) T420I probably damaging Het
Slc9a9 A G 9: 94,818,493 (GRCm39) T296A probably benign Het
Smyd2 G A 1: 189,628,833 (GRCm39) H157Y probably damaging Het
Spata32 T A 11: 103,100,677 (GRCm39) H30L probably benign Het
Srarp T C 4: 141,160,344 (GRCm39) E163G possibly damaging Het
Tcstv2a A G 13: 120,725,746 (GRCm39) T137A probably damaging Het
Tmed8 A G 12: 87,220,938 (GRCm39) I216T probably damaging Het
Tnni3k A T 3: 154,562,186 (GRCm39) L697Q probably damaging Het
Tra2b G A 16: 22,065,940 (GRCm39) R286C unknown Het
Trav7-6 A G 14: 53,954,604 (GRCm39) K65E probably benign Het
Ttn T C 2: 76,540,506 (GRCm39) D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 (GRCm39) C36* probably null Het
Ush2a A T 1: 188,638,676 (GRCm39) T4029S probably damaging Het
Usp9y C T Y: 1,316,978 (GRCm39) S1857N probably benign Het
Vwa3b A G 1: 37,154,767 (GRCm39) N517S probably damaging Het
Zfp583 G A 7: 6,319,627 (GRCm39) P462S probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106,924,110 (GRCm39) missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 106,928,484 (GRCm39) missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106,926,688 (GRCm39) missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106,926,640 (GRCm39) missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106,926,751 (GRCm39) missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 106,928,466 (GRCm39) missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106,909,886 (GRCm39) start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106,926,756 (GRCm39) missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 106,928,157 (GRCm39) missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106,910,568 (GRCm39) missense probably null 0.15
R3418:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106,926,657 (GRCm39) missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106,926,302 (GRCm39) missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106,910,574 (GRCm39) missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106,926,427 (GRCm39) missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106,909,915 (GRCm39) missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106,926,332 (GRCm39) missense probably benign 0.00
R6015:Serpinb13 UTSW 1 106,928,337 (GRCm39) missense probably benign 0.00
R6363:Serpinb13 UTSW 1 106,928,504 (GRCm39) nonsense probably null
R6720:Serpinb13 UTSW 1 106,921,792 (GRCm39) missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106,926,663 (GRCm39) missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106,926,679 (GRCm39) missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 106,928,519 (GRCm39) missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 106,928,165 (GRCm39) missense probably damaging 1.00
R9350:Serpinb13 UTSW 1 106,923,562 (GRCm39) nonsense probably null
R9375:Serpinb13 UTSW 1 106,909,997 (GRCm39) missense probably damaging 1.00
R9774:Serpinb13 UTSW 1 106,923,579 (GRCm39) missense probably benign 0.02
Z1177:Serpinb13 UTSW 1 106,910,033 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCATCTGACTTGGCAGAAAG -3'
(R):5'- GAAATAGTCCCATGGCAAGCAG -3'

Sequencing Primer
(F):5'- CTTGGCAGAAAGTCAAATGGC -3'
(R):5'- CAGGGATACTGGCCATTTCTTG -3'
Posted On 2021-10-11