Incidental Mutation 'R9011:Slc7a14'
ID 685622
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 31202858-31310378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31224196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 420 (T420I)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: T420I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: T420I

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: T420I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: T420I

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,304 I176F possibly damaging Het
Actr10 A G 12: 70,952,960 T177A probably benign Het
Adgrb2 G A 4: 130,022,318 D1468N probably damaging Het
AF067061 A G 13: 120,264,210 T137A probably damaging Het
Aldh16a1 A G 7: 45,145,527 F506S probably damaging Het
Ankfn1 A T 11: 89,526,618 M56K probably benign Het
Atxn7l2 T C 3: 108,207,440 S97G probably benign Het
Cacna1g C T 11: 94,415,837 G1905D probably benign Het
Ccne1 A T 7: 38,106,660 M13K probably benign Het
Chil3 A T 3: 106,149,715 Y304* probably null Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Cldn23 T A 8: 35,825,672 I221F probably damaging Het
Col16a1 T C 4: 130,052,859 F92L unknown Het
Col6a3 A T 1: 90,782,335 probably benign Het
Cyp2w1 T A 5: 139,354,559 V199E possibly damaging Het
Dmxl1 A G 18: 49,864,173 Y512C probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif3l T G 15: 79,089,525 M380R possibly damaging Het
Fam71a A C 1: 191,163,061 S462A probably benign Het
Fer1l5 A T 1: 36,402,520 K605N probably damaging Het
Fgfbp1 T G 5: 43,979,285 N222H probably benign Het
Flcn A G 11: 59,799,407 L273P possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gabpa A G 16: 84,841,321 probably benign Het
Gfi1 A G 5: 107,725,559 probably null Het
Ift57 A G 16: 49,759,414 Q316R probably benign Het
Itga11 T C 9: 62,755,627 F542L probably benign Het
Kif28 G C 1: 179,702,419 L726V possibly damaging Het
Krt90 A G 15: 101,562,800 I9T probably benign Het
Lefty1 A T 1: 180,937,676 M270L probably benign Het
Mipol1 A T 12: 57,457,079 E344D probably benign Het
Mon2 A T 10: 123,026,308 M737K possibly damaging Het
Mrpl14 A G 17: 45,698,404 N143S probably benign Het
Nelfcd T A 2: 174,426,924 H589Q probably benign Het
Npepps T C 11: 97,240,931 M366V probably damaging Het
Olfr1448 A T 19: 12,920,115 S65T probably damaging Het
Platr25 T A 13: 62,700,466 H194L probably damaging Het
Plekhg4 T C 8: 105,375,652 I127T probably benign Het
Ralgapa1 A T 12: 55,605,529 probably benign Het
Rarb A G 14: 16,435,140 V302A probably damaging Het
Rc3h1 A C 1: 160,965,103 T1037P probably damaging Het
Rnaset2a G A 17: 8,137,928 P102S probably damaging Het
Scn10a A C 9: 119,630,094 S1166R probably damaging Het
Scn3a A G 2: 65,521,826 M380T possibly damaging Het
Serpinb13 A G 1: 106,995,789 I75V probably benign Het
Slc35f5 G A 1: 125,562,313 A27T probably benign Het
Slc45a3 G A 1: 131,977,976 V246I probably benign Het
Slc9a9 A G 9: 94,936,440 T296A probably benign Het
Smyd2 G A 1: 189,896,636 H157Y probably damaging Het
Spata32 T A 11: 103,209,851 H30L probably benign Het
Srarp T C 4: 141,433,033 E163G possibly damaging Het
Tmed8 A G 12: 87,174,164 I216T probably damaging Het
Tnni3k A T 3: 154,856,549 L697Q probably damaging Het
Tra2b G A 16: 22,247,190 R286C unknown Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Ttn T C 2: 76,710,162 D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 C36* probably null Het
Ush2a A T 1: 188,906,479 T4029S probably damaging Het
Usp9y C T Y: 1,316,978 S1857N probably benign Het
Vwa3b A G 1: 37,115,686 N517S probably damaging Het
Zfp583 G A 7: 6,316,628 P462S probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
R9208:Slc7a14 UTSW 3 31227210 missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31224017 missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGCTGGGCTGGAAAATTC -3'
(R):5'- GTTGCAGTTCTAACACACTGG -3'

Sequencing Primer
(F):5'- CCTCCCCTTCACTCACAGGAG -3'
(R):5'- TTGGTCACCATGGGTACTACAAC -3'
Posted On 2021-10-11