Incidental Mutation 'R9011:Chst15'
ID 685637
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 132270517 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000079105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect probably benign
Transcript: ENSMUST00000077472
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: F12L

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080215
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: F12L

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132508
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A T 18: 57,667,304 I176F possibly damaging Het
Actr10 A G 12: 70,952,960 T177A probably benign Het
Adgrb2 G A 4: 130,022,318 D1468N probably damaging Het
AF067061 A G 13: 120,264,210 T137A probably damaging Het
Aldh16a1 A G 7: 45,145,527 F506S probably damaging Het
Ankfn1 A T 11: 89,526,618 M56K probably benign Het
Atxn7l2 T C 3: 108,207,440 S97G probably benign Het
Cacna1g C T 11: 94,415,837 G1905D probably benign Het
Ccne1 A T 7: 38,106,660 M13K probably benign Het
Chil3 A T 3: 106,149,715 Y304* probably null Het
Cldn23 T A 8: 35,825,672 I221F probably damaging Het
Col16a1 T C 4: 130,052,859 F92L unknown Het
Cyp2w1 T A 5: 139,354,559 V199E possibly damaging Het
Dmxl1 A G 18: 49,864,173 Y512C probably damaging Het
Dopey1 A T 9: 86,515,343 H900L probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Eif3l T G 15: 79,089,525 M380R possibly damaging Het
Fam71a A C 1: 191,163,061 S462A probably benign Het
Fer1l5 A T 1: 36,402,520 K605N probably damaging Het
Fgfbp1 T G 5: 43,979,285 N222H probably benign Het
Flcn A G 11: 59,799,407 L273P possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gfi1 A G 5: 107,725,559 probably null Het
Ift57 A G 16: 49,759,414 Q316R probably benign Het
Itga11 T C 9: 62,755,627 F542L probably benign Het
Kif28 G C 1: 179,702,419 L726V possibly damaging Het
Krt90 A G 15: 101,562,800 I9T probably benign Het
Lefty1 A T 1: 180,937,676 M270L probably benign Het
Mipol1 A T 12: 57,457,079 E344D probably benign Het
Mon2 A T 10: 123,026,308 M737K possibly damaging Het
Mrpl14 A G 17: 45,698,404 N143S probably benign Het
Nelfcd T A 2: 174,426,924 H589Q probably benign Het
Npepps T C 11: 97,240,931 M366V probably damaging Het
Olfr1448 A T 19: 12,920,115 S65T probably damaging Het
Platr25 T A 13: 62,700,466 H194L probably damaging Het
Plekhg4 T C 8: 105,375,652 I127T probably benign Het
Rarb A G 14: 16,435,140 V302A probably damaging Het
Rc3h1 A C 1: 160,965,103 T1037P probably damaging Het
Rnaset2a G A 17: 8,137,928 P102S probably damaging Het
Scn10a A C 9: 119,630,094 S1166R probably damaging Het
Scn3a A G 2: 65,521,826 M380T possibly damaging Het
Serpinb13 A G 1: 106,995,789 I75V probably benign Het
Slc35f5 G A 1: 125,562,313 A27T probably benign Het
Slc45a3 G A 1: 131,977,976 V246I probably benign Het
Slc7a14 G A 3: 31,224,196 T420I probably damaging Het
Slc9a9 A G 9: 94,936,440 T296A probably benign Het
Smyd2 G A 1: 189,896,636 H157Y probably damaging Het
Spata32 T A 11: 103,209,851 H30L probably benign Het
Srarp T C 4: 141,433,033 E163G possibly damaging Het
Tmed8 A G 12: 87,174,164 I216T probably damaging Het
Tnni3k A T 3: 154,856,549 L697Q probably damaging Het
Tra2b G A 16: 22,247,190 R286C unknown Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Ttn T C 2: 76,710,162 D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 C36* probably null Het
Ush2a A T 1: 188,906,479 T4029S probably damaging Het
Usp9y C T Y: 1,316,978 S1857N probably benign Het
Vwa3b A G 1: 37,115,686 N517S probably damaging Het
Zfp583 G A 7: 6,316,628 P462S probably damaging Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R7911:Chst15 UTSW 7 132270522 missense probably benign 0.12
R8282:Chst15 UTSW 7 132270150 missense probably benign
R8342:Chst15 UTSW 7 132247886 missense probably benign 0.15
R9093:Chst15 UTSW 7 132268917 critical splice donor site probably null
R9329:Chst15 UTSW 7 132266791 missense possibly damaging 0.46
R9352:Chst15 UTSW 7 132270528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCAGGCTACATCGCTTC -3'
(R):5'- CCAAAGACTGTGCCTCATTCTC -3'

Sequencing Primer
(F):5'- AAAAACCCACCCCAGTTTTCATTG -3'
(R):5'- AAAGACTGTGCCTCATTCTCTAGTG -3'
Posted On 2021-10-11