Incidental Mutation 'R9011:Dmxl1'
ID 685663
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 068841-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R9011 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49997240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 512 (Y512C)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: Y512C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: Y512C

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: Y512C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: Y512C

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,999,734 (GRCm39) T177A probably benign Het
Adgrb2 G A 4: 129,916,111 (GRCm39) D1468N probably damaging Het
Aldh16a1 A G 7: 44,794,951 (GRCm39) F506S probably damaging Het
Ankfn1 A T 11: 89,417,444 (GRCm39) M56K probably benign Het
Atxn7l2 T C 3: 108,114,756 (GRCm39) S97G probably benign Het
Cacna1g C T 11: 94,306,663 (GRCm39) G1905D probably benign Het
Ccdc192 A T 18: 57,800,376 (GRCm39) I176F possibly damaging Het
Ccne1 A T 7: 37,806,085 (GRCm39) M13K probably benign Het
Chil3 A T 3: 106,057,031 (GRCm39) Y304* probably null Het
Chst15 A G 7: 131,872,246 (GRCm39) F12L probably benign Het
Cldn23 T A 8: 36,292,826 (GRCm39) I221F probably damaging Het
Col16a1 T C 4: 129,946,652 (GRCm39) F92L unknown Het
Col6a3 A T 1: 90,710,057 (GRCm39) probably benign Het
Cyp2w1 T A 5: 139,340,314 (GRCm39) V199E possibly damaging Het
Dop1a A T 9: 86,397,396 (GRCm39) H900L probably damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Eif3l T G 15: 78,973,725 (GRCm39) M380R possibly damaging Het
Fer1l5 A T 1: 36,441,601 (GRCm39) K605N probably damaging Het
Fgfbp1 T G 5: 44,136,627 (GRCm39) N222H probably benign Het
Flcn A G 11: 59,690,233 (GRCm39) L273P possibly damaging Het
Fzd10 C G 5: 128,679,369 (GRCm39) P363R probably damaging Het
Gabpa A G 16: 84,638,209 (GRCm39) probably benign Het
Garin4 A C 1: 190,895,258 (GRCm39) S462A probably benign Het
Gfi1 A G 5: 107,873,425 (GRCm39) probably null Het
Ift57 A G 16: 49,579,777 (GRCm39) Q316R probably benign Het
Itga11 T C 9: 62,662,909 (GRCm39) F542L probably benign Het
Kif28 G C 1: 179,529,984 (GRCm39) L726V possibly damaging Het
Krt90 A G 15: 101,471,235 (GRCm39) I9T probably benign Het
Lefty1 A T 1: 180,765,241 (GRCm39) M270L probably benign Het
Mipol1 A T 12: 57,503,865 (GRCm39) E344D probably benign Het
Mon2 A T 10: 122,862,213 (GRCm39) M737K possibly damaging Het
Mrpl14 A G 17: 46,009,330 (GRCm39) N143S probably benign Het
Nelfcd T A 2: 174,268,717 (GRCm39) H589Q probably benign Het
Npepps T C 11: 97,131,757 (GRCm39) M366V probably damaging Het
Or5b12 A T 19: 12,897,479 (GRCm39) S65T probably damaging Het
Platr25 T A 13: 62,848,280 (GRCm39) H194L probably damaging Het
Plekhg4 T C 8: 106,102,284 (GRCm39) I127T probably benign Het
Ralgapa1 A T 12: 55,652,314 (GRCm39) probably benign Het
Rarb A G 14: 16,435,140 (GRCm38) V302A probably damaging Het
Rc3h1 A C 1: 160,792,673 (GRCm39) T1037P probably damaging Het
Rnaset2a G A 17: 8,356,760 (GRCm39) P102S probably damaging Het
Scn10a A C 9: 119,459,160 (GRCm39) S1166R probably damaging Het
Scn3a A G 2: 65,352,170 (GRCm39) M380T possibly damaging Het
Serpinb13 A G 1: 106,923,519 (GRCm39) I75V probably benign Het
Slc35f5 G A 1: 125,490,050 (GRCm39) A27T probably benign Het
Slc45a3 G A 1: 131,905,714 (GRCm39) V246I probably benign Het
Slc7a14 G A 3: 31,278,345 (GRCm39) T420I probably damaging Het
Slc9a9 A G 9: 94,818,493 (GRCm39) T296A probably benign Het
Smyd2 G A 1: 189,628,833 (GRCm39) H157Y probably damaging Het
Spata32 T A 11: 103,100,677 (GRCm39) H30L probably benign Het
Srarp T C 4: 141,160,344 (GRCm39) E163G possibly damaging Het
Tcstv2a A G 13: 120,725,746 (GRCm39) T137A probably damaging Het
Tmed8 A G 12: 87,220,938 (GRCm39) I216T probably damaging Het
Tnni3k A T 3: 154,562,186 (GRCm39) L697Q probably damaging Het
Tra2b G A 16: 22,065,940 (GRCm39) R286C unknown Het
Trav7-6 A G 14: 53,954,604 (GRCm39) K65E probably benign Het
Ttn T C 2: 76,540,506 (GRCm39) D34160G possibly damaging Het
Umad1 T A 6: 8,373,931 (GRCm39) C36* probably null Het
Ush2a A T 1: 188,638,676 (GRCm39) T4029S probably damaging Het
Usp9y C T Y: 1,316,978 (GRCm39) S1857N probably benign Het
Vwa3b A G 1: 37,154,767 (GRCm39) N517S probably damaging Het
Zfp583 G A 7: 6,319,627 (GRCm39) P462S probably damaging Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTTGCTTATAGAACTGGATGATGG -3'
(R):5'- ATCACCTGTGGGGAAAGCTAC -3'

Sequencing Primer
(F):5'- ATAGAACTGGATGATGGTGTTGATG -3'
(R):5'- GAAAGTGGGTGTTAGAACAT -3'
Posted On 2021-10-11