Incidental Mutation 'R9012:Vwa3b'
ID 685668
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9012 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37085310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 330 (S330G)
Ref Sequence ENSEMBL: ENSMUSP00000027289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
AA Change: S330G

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122
AA Change: S330G

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A G 17: 25,947,711 L284P probably benign Het
Agt T C 8: 124,564,215 N118D probably benign Het
Apol8 T C 15: 77,750,124 D84G probably benign Het
Arl6ip5 T A 6: 97,210,877 D19E probably benign Het
B3gnt3 G T 8: 71,693,029 H232N probably damaging Het
Btbd10 T C 7: 113,322,757 K347R probably damaging Het
Capn5 C T 7: 98,164,843 probably benign Het
Ccdc181 C T 1: 164,282,493 R390W probably damaging Het
Cdc42bpa T C 1: 180,031,512 V93A Het
Clcn1 A G 6: 42,291,633 I191V possibly damaging Het
Coro1c T C 5: 113,850,676 D202G probably damaging Het
Cul9 A G 17: 46,543,521 I85T probably benign Het
Cyp2c55 C T 19: 39,042,116 T464I probably benign Het
Dlgap1 G A 17: 70,516,187 E56K possibly damaging Het
Dnajc6 T C 4: 101,612,959 F298L probably damaging Het
E130311K13Rik A T 3: 63,915,513 W237R probably damaging Het
Fes T A 7: 80,383,136 D287V possibly damaging Het
Fstl5 G T 3: 76,659,720 W557L probably damaging Het
Gad2 A G 2: 22,690,251 N555D possibly damaging Het
Gm10277 C T 11: 77,786,022 R41K unknown Het
Gm11639 G A 11: 104,820,521 probably null Het
Gm21834 T C 17: 57,742,167 E18G probably null Het
Hnrnpul2 T C 19: 8,824,465 F346L possibly damaging Het
Hspa4 A T 11: 53,268,575 V524E probably benign Het
Ikbke T C 1: 131,273,453 I207V probably damaging Het
Iqsec3 T C 6: 121,413,037 I492V unknown Het
Itsn1 C A 16: 91,848,961 F846L unknown Het
Ldhal6b A T 17: 5,417,667 Y331N probably damaging Het
Lrrc37a T G 11: 103,499,152 T1816P probably benign Het
Lzts1 C T 8: 69,140,898 R19H probably damaging Het
Maats1 T C 16: 38,301,973 E712G probably damaging Het
Mast4 T A 13: 102,798,098 T338S probably benign Het
Mst1r A G 9: 107,914,761 E832G probably benign Het
Myom1 T G 17: 71,100,108 D1173E probably benign Het
Nlrp9c T A 7: 26,375,308 I821F probably benign Het
Obscn T C 11: 59,130,597 K806E probably benign Het
Olfr1225 A G 2: 89,170,585 I209T possibly damaging Het
Olfr695 T C 7: 106,713,908 M258V probably benign Het
Olfr811 A C 10: 129,801,602 S308A probably benign Het
Palld T A 8: 61,720,663 S321C possibly damaging Het
Pank4 C A 4: 154,978,390 probably benign Het
Psg26 T A 7: 18,482,671 H81L probably benign Het
Ptprq C T 10: 107,653,550 E905K probably benign Het
Siglecg T A 7: 43,411,099 L301Q probably damaging Het
Slc25a15 A G 8: 22,377,862 W301R probably benign Het
Slco1b2 T A 6: 141,656,828 V169D probably damaging Het
Sned1 T C 1: 93,284,598 V1174A probably damaging Het
Sorl1 A G 9: 42,071,195 V363A probably damaging Het
Sppl3 C A 5: 115,088,928 P239T probably benign Het
Stox1 A T 10: 62,664,832 S650T probably benign Het
Tbc1d9b A G 11: 50,149,861 T402A probably benign Het
Tmem104 A T 11: 115,201,318 E84D probably benign Het
Tox4 T C 14: 52,285,751 V56A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Treml2 A G 17: 48,308,062 T192A possibly damaging Het
Vmn2r110 T C 17: 20,583,365 D316G probably damaging Het
Vmn2r5 A T 3: 64,504,494 W218R probably damaging Het
Wdr81 A G 11: 75,449,145 V220A possibly damaging Het
Zbbx A G 3: 75,061,653 S504P possibly damaging Het
Zfp68 A T 5: 138,607,021 C347S probably damaging Het
Zfp936 T A 7: 43,189,992 C294* probably null Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAATCTTAGTCCTGATTCTCAG -3'
(R):5'- GAGCGAAGGAACTCTGCTAG -3'

Sequencing Primer
(F):5'- GATATTCAGAGCTGCTCTCGACAG -3'
(R):5'- GCGAAGGAACTCTGCTAGAAATACTC -3'
Posted On 2021-10-11