Incidental Mutation 'R9012:Capn5'
ID 685692
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 068842-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9012 (G1)
Quality Score 178.009
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 97814050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112] [ENSMUST00000129430] [ENSMUST00000155056]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129430
Predicted Effect probably benign
Transcript: ENSMUST00000155056
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agt T C 8: 125,290,954 (GRCm39) N118D probably benign Het
Apol8 T C 15: 77,634,324 (GRCm39) D84G probably benign Het
Arl6ip5 T A 6: 97,187,838 (GRCm39) D19E probably benign Het
B3gnt3 G T 8: 72,145,673 (GRCm39) H232N probably damaging Het
Btbd10 T C 7: 112,921,964 (GRCm39) K347R probably damaging Het
Ccdc181 C T 1: 164,110,062 (GRCm39) R390W probably damaging Het
Cdc42bpa T C 1: 179,859,077 (GRCm39) V93A Het
Cfap91 T C 16: 38,122,335 (GRCm39) E712G probably damaging Het
Clcn1 A G 6: 42,268,567 (GRCm39) I191V possibly damaging Het
Coro1c T C 5: 113,988,737 (GRCm39) D202G probably damaging Het
Cul9 A G 17: 46,854,447 (GRCm39) I85T probably benign Het
Cyp2c55 C T 19: 39,030,560 (GRCm39) T464I probably benign Het
Dlgap1 G A 17: 70,823,182 (GRCm39) E56K possibly damaging Het
Dnajc6 T C 4: 101,470,156 (GRCm39) F298L probably damaging Het
E130311K13Rik A T 3: 63,822,934 (GRCm39) W237R probably damaging Het
Efcab3 G A 11: 104,711,347 (GRCm39) probably null Het
Fes T A 7: 80,032,884 (GRCm39) D287V possibly damaging Het
Fstl5 G T 3: 76,567,027 (GRCm39) W557L probably damaging Het
Gad2 A G 2: 22,580,263 (GRCm39) N555D possibly damaging Het
Gm10277 C T 11: 77,676,848 (GRCm39) R41K unknown Het
Gm21834 T C 17: 58,049,162 (GRCm39) E18G probably null Het
Hnrnpul2 T C 19: 8,801,829 (GRCm39) F346L possibly damaging Het
Hspa4 A T 11: 53,159,402 (GRCm39) V524E probably benign Het
Ikbke T C 1: 131,201,190 (GRCm39) I207V probably damaging Het
Iqsec3 T C 6: 121,389,996 (GRCm39) I492V unknown Het
Itsn1 C A 16: 91,645,849 (GRCm39) F846L unknown Het
Ldhal6b A T 17: 5,467,942 (GRCm39) Y331N probably damaging Het
Lrrc37a T G 11: 103,389,978 (GRCm39) T1816P probably benign Het
Lzts1 C T 8: 69,593,550 (GRCm39) R19H probably damaging Het
Mast4 T A 13: 102,934,606 (GRCm39) T338S probably benign Het
Mst1r A G 9: 107,791,960 (GRCm39) E832G probably benign Het
Myom1 T G 17: 71,407,103 (GRCm39) D1173E probably benign Het
Nlrp9c T A 7: 26,074,733 (GRCm39) I821F probably benign Het
Obscn T C 11: 59,021,423 (GRCm39) K806E probably benign Het
Or2ag13 T C 7: 106,313,115 (GRCm39) M258V probably benign Het
Or4c120 A G 2: 89,000,929 (GRCm39) I209T possibly damaging Het
Or6c215 A C 10: 129,637,471 (GRCm39) S308A probably benign Het
Palld T A 8: 62,173,697 (GRCm39) S321C possibly damaging Het
Pank4 C A 4: 155,062,847 (GRCm39) probably benign Het
Prr35 A G 17: 26,166,685 (GRCm39) L284P probably benign Het
Psg26 T A 7: 18,216,596 (GRCm39) H81L probably benign Het
Ptprq C T 10: 107,489,411 (GRCm39) E905K probably benign Het
Siglecg T A 7: 43,060,523 (GRCm39) L301Q probably damaging Het
Slc25a15 A G 8: 22,867,878 (GRCm39) W301R probably benign Het
Slco1b2 T A 6: 141,602,554 (GRCm39) V169D probably damaging Het
Sned1 T C 1: 93,212,320 (GRCm39) V1174A probably damaging Het
Sorl1 A G 9: 41,982,491 (GRCm39) V363A probably damaging Het
Sppl3 C A 5: 115,226,987 (GRCm39) P239T probably benign Het
Stox1 A T 10: 62,500,611 (GRCm39) S650T probably benign Het
Tbc1d9b A G 11: 50,040,688 (GRCm39) T402A probably benign Het
Tmem104 A T 11: 115,092,144 (GRCm39) E84D probably benign Het
Tox4 T C 14: 52,523,208 (GRCm39) V56A probably benign Het
Trav7-6 A G 14: 53,954,604 (GRCm39) K65E probably benign Het
Treml2 A G 17: 48,615,090 (GRCm39) T192A possibly damaging Het
Vmn2r110 T C 17: 20,803,627 (GRCm39) D316G probably damaging Het
Vmn2r5 A T 3: 64,411,915 (GRCm39) W218R probably damaging Het
Vwa3b A G 1: 37,124,391 (GRCm39) S330G probably benign Het
Wdr81 A G 11: 75,339,971 (GRCm39) V220A possibly damaging Het
Zbbx A G 3: 74,968,960 (GRCm39) S504P possibly damaging Het
Zfp68 A T 5: 138,605,283 (GRCm39) C347S probably damaging Het
Zfp936 T A 7: 42,839,416 (GRCm39) C294* probably null Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7095:Capn5 UTSW 7 97,775,038 (GRCm39) missense probably benign 0.10
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCAGGGCATTTGCAC -3'
(R):5'- AGCAACTTCCTTTAGAGCCCC -3'

Sequencing Primer
(F):5'- GGCATTTGCACAAGCCTC -3'
(R):5'- TTTAGAGCCCCACCCCC -3'
Posted On 2021-10-11