Incidental Mutation 'R9012:Treml2'
ID 685723
Institutional Source Beutler Lab
Gene Symbol Treml2
Ensembl Gene ENSMUSG00000071068
Gene Name triggering receptor expressed on myeloid cells-like 2
Synonyms LOC328833
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9012 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 48300038-48312534 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48308062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 192 (T192A)
Ref Sequence ENSEMBL: ENSMUSP00000128215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170941]
AlphaFold Q2LA85
Predicted Effect possibly damaging
Transcript: ENSMUST00000170941
AA Change: T192A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: T192A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 129 3.13e-5 SMART
low complexity region 181 199 N/A INTRINSIC
transmembrane domain 268 290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A G 17: 25,947,711 L284P probably benign Het
Agt T C 8: 124,564,215 N118D probably benign Het
Apol8 T C 15: 77,750,124 D84G probably benign Het
Arl6ip5 T A 6: 97,210,877 D19E probably benign Het
B3gnt3 G T 8: 71,693,029 H232N probably damaging Het
Btbd10 T C 7: 113,322,757 K347R probably damaging Het
Capn5 C T 7: 98,164,843 probably benign Het
Ccdc181 C T 1: 164,282,493 R390W probably damaging Het
Cdc42bpa T C 1: 180,031,512 V93A Het
Clcn1 A G 6: 42,291,633 I191V possibly damaging Het
Coro1c T C 5: 113,850,676 D202G probably damaging Het
Cul9 A G 17: 46,543,521 I85T probably benign Het
Cyp2c55 C T 19: 39,042,116 T464I probably benign Het
Dlgap1 G A 17: 70,516,187 E56K possibly damaging Het
Dnajc6 T C 4: 101,612,959 F298L probably damaging Het
E130311K13Rik A T 3: 63,915,513 W237R probably damaging Het
Fes T A 7: 80,383,136 D287V possibly damaging Het
Fstl5 G T 3: 76,659,720 W557L probably damaging Het
Gad2 A G 2: 22,690,251 N555D possibly damaging Het
Gm10277 C T 11: 77,786,022 R41K unknown Het
Gm11639 G A 11: 104,820,521 probably null Het
Gm21834 T C 17: 57,742,167 E18G probably null Het
Hnrnpul2 T C 19: 8,824,465 F346L possibly damaging Het
Hspa4 A T 11: 53,268,575 V524E probably benign Het
Ikbke T C 1: 131,273,453 I207V probably damaging Het
Iqsec3 T C 6: 121,413,037 I492V unknown Het
Itsn1 C A 16: 91,848,961 F846L unknown Het
Ldhal6b A T 17: 5,417,667 Y331N probably damaging Het
Lrrc37a T G 11: 103,499,152 T1816P probably benign Het
Lzts1 C T 8: 69,140,898 R19H probably damaging Het
Maats1 T C 16: 38,301,973 E712G probably damaging Het
Mast4 T A 13: 102,798,098 T338S probably benign Het
Mst1r A G 9: 107,914,761 E832G probably benign Het
Myom1 T G 17: 71,100,108 D1173E probably benign Het
Nlrp9c T A 7: 26,375,308 I821F probably benign Het
Obscn T C 11: 59,130,597 K806E probably benign Het
Olfr1225 A G 2: 89,170,585 I209T possibly damaging Het
Olfr695 T C 7: 106,713,908 M258V probably benign Het
Olfr811 A C 10: 129,801,602 S308A probably benign Het
Palld T A 8: 61,720,663 S321C possibly damaging Het
Pank4 C A 4: 154,978,390 probably benign Het
Psg26 T A 7: 18,482,671 H81L probably benign Het
Ptprq C T 10: 107,653,550 E905K probably benign Het
Siglecg T A 7: 43,411,099 L301Q probably damaging Het
Slc25a15 A G 8: 22,377,862 W301R probably benign Het
Slco1b2 T A 6: 141,656,828 V169D probably damaging Het
Sned1 T C 1: 93,284,598 V1174A probably damaging Het
Sorl1 A G 9: 42,071,195 V363A probably damaging Het
Sppl3 C A 5: 115,088,928 P239T probably benign Het
Stox1 A T 10: 62,664,832 S650T probably benign Het
Tbc1d9b A G 11: 50,149,861 T402A probably benign Het
Tmem104 A T 11: 115,201,318 E84D probably benign Het
Tox4 T C 14: 52,285,751 V56A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Vmn2r110 T C 17: 20,583,365 D316G probably damaging Het
Vmn2r5 A T 3: 64,504,494 W218R probably damaging Het
Vwa3b A G 1: 37,085,310 S330G probably benign Het
Wdr81 A G 11: 75,449,145 V220A possibly damaging Het
Zbbx A G 3: 75,061,653 S504P possibly damaging Het
Zfp68 A T 5: 138,607,021 C347S probably damaging Het
Zfp936 T A 7: 43,189,992 C294* probably null Het
Other mutations in Treml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Treml2 APN 17 48302810 missense probably benign
IGL02797:Treml2 APN 17 48302711 missense possibly damaging 0.73
Cottonwood UTSW 17 48302747 missense possibly damaging 0.89
poplar UTSW 17 48302734 nonsense probably null
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0105:Treml2 UTSW 17 48302828 missense probably damaging 0.99
R0670:Treml2 UTSW 17 48307836 splice site probably null
R1538:Treml2 UTSW 17 48302758 missense possibly damaging 0.77
R1796:Treml2 UTSW 17 48309502 makesense probably null
R4396:Treml2 UTSW 17 48308114 missense probably benign 0.00
R4679:Treml2 UTSW 17 48308175 missense probably benign 0.36
R4687:Treml2 UTSW 17 48309397 splice site probably null
R4801:Treml2 UTSW 17 48309159 missense probably benign 0.18
R4802:Treml2 UTSW 17 48309159 missense probably benign 0.18
R5314:Treml2 UTSW 17 48300573 missense probably damaging 0.99
R6791:Treml2 UTSW 17 48309219 missense probably benign 0.24
R6818:Treml2 UTSW 17 48302897 missense probably damaging 1.00
R6958:Treml2 UTSW 17 48308152 missense probably damaging 1.00
R7250:Treml2 UTSW 17 48309127 missense probably benign 0.05
R7535:Treml2 UTSW 17 48302819 missense probably damaging 1.00
R7850:Treml2 UTSW 17 48308140 missense probably benign 0.01
R8049:Treml2 UTSW 17 48302734 nonsense probably null
R8998:Treml2 UTSW 17 48302747 missense possibly damaging 0.89
R9208:Treml2 UTSW 17 48307894 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCCCTCACAACTGAGAG -3'
(R):5'- ATAACCTGTTGGGAGTTAACGG -3'

Sequencing Primer
(F):5'- TCACAACTGAGAGAAACGTTCC -3'
(R):5'- GTGGTGGACAAGCTGCTACTC -3'
Posted On 2021-10-11