Incidental Mutation 'R9013:Fzd10'
ID 685749
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9013 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 128602305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 363 (P363R)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect probably damaging
Transcript: ENSMUST00000117102
AA Change: P363R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: P363R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G T 14: 70,156,727 L200I probably damaging Het
Afap1 G A 5: 35,976,588 D456N possibly damaging Het
Afm A T 5: 90,523,735 D92V probably damaging Het
Ahi1 T C 10: 21,007,759 I841T probably benign Het
Asb1 T C 1: 91,552,441 probably null Het
Astn1 A T 1: 158,520,500 I507F probably damaging Het
Astn2 A G 4: 65,992,347 M468T probably benign Het
C030006K11Rik T C 15: 76,723,804 S5G probably benign Het
C9 A T 15: 6,486,712 D332V probably damaging Het
Cacna1c A T 6: 118,742,305 S423T probably damaging Het
Cbx8 T C 11: 119,038,823 I315V possibly damaging Het
Ccdc50 T A 16: 27,409,356 I91N probably damaging Het
Col4a1 T A 8: 11,222,270 I707L probably benign Het
Cyc1 T C 15: 76,344,819 V154A possibly damaging Het
Cyp4f40 A T 17: 32,671,199 H281L probably benign Het
D130052B06Rik T G 11: 33,623,491 C74W unknown Het
Dap G A 15: 31,273,198 G66D probably damaging Het
Dclk3 A T 9: 111,468,498 H370L probably benign Het
Dgka C A 10: 128,730,202 E360* probably null Het
Dst A G 1: 34,178,084 I1202V possibly damaging Het
Gm340 T A 19: 41,584,750 V648D probably damaging Het
Gm4869 A T 5: 140,463,613 Y180F probably damaging Het
Gm906 T C 13: 50,247,552 H246R possibly damaging Het
Gpx2 A G 12: 76,795,344 L11P probably damaging Het
Greb1 A G 12: 16,739,969 L26S probably damaging Het
Gtpbp2 A G 17: 46,164,814 K163R probably benign Het
Hsd3b1 A T 3: 98,852,661 L338Q probably damaging Het
Il15ra A G 2: 11,727,765 S67G probably benign Het
Kcnc2 C T 10: 112,271,818 A38V probably damaging Het
Klk1b16 A G 7: 44,140,908 D169G probably benign Het
Kmt2a T C 9: 44,849,911 K214E probably damaging Het
Lrriq1 C T 10: 103,215,070 G607D probably damaging Het
Lysmd3 T A 13: 81,669,461 S186T probably damaging Het
Meis1 G T 11: 19,016,354 D6E probably benign Het
Mfsd4b2 T G 10: 39,922,066 T98P probably benign Het
Muc16 T A 9: 18,512,773 E8193V possibly damaging Het
Nr1i3 A G 1: 171,214,457 T37A probably damaging Het
Nr5a2 A T 1: 136,945,007 D112E probably damaging Het
Oas1c A G 5: 120,805,432 I214T probably damaging Het
Olfr109 G A 17: 37,466,550 V115M probably benign Het
Olfr271-ps1 C A 4: 52,935,900 A128S probably benign Het
Olfr482 A G 7: 108,095,264 I102T probably benign Het
Olfr533 A T 7: 140,466,266 R22W probably benign Het
Olfr800 T C 10: 129,659,833 F9S probably damaging Het
Olfr834 A T 9: 18,988,578 I197F possibly damaging Het
Omp A G 7: 98,145,345 M25T probably benign Het
Paf1 A G 7: 28,398,708 E381G unknown Het
Pcdhga8 A G 18: 37,725,944 T18A probably benign Het
Pclo T C 5: 14,677,613 S2162P unknown Het
Psg25 T C 7: 18,524,765 I329V probably benign Het
Ptov1 A G 7: 44,865,561 S209P possibly damaging Het
Ralgapb A G 2: 158,437,140 K397E probably damaging Het
Ryr2 T A 13: 11,603,732 T3866S probably damaging Het
Sdccag8 G A 1: 176,824,805 V41I probably benign Het
Sdf2l1 T A 16: 17,130,766 D136V possibly damaging Het
Slc26a7 A T 4: 14,506,514 S612T probably damaging Het
Snf8 T C 11: 96,039,300 F43L probably benign Het
Snta1 A T 2: 154,403,889 M104K probably damaging Het
Sox2 T A 3: 34,650,597 M61K probably damaging Het
Spats2 T A 15: 99,199,247 D293E probably damaging Het
Spta1 A G 1: 174,222,608 D1738G probably damaging Het
Sqstm1 A T 11: 50,207,857 Y89N probably damaging Het
Stat4 T A 1: 52,011,798 N5K probably benign Het
Syne4 A G 7: 30,317,993 H294R probably damaging Het
Tbc1d7 A C 13: 43,168,834 F45V probably damaging Het
Tekt3 T A 11: 63,083,858 N334K probably damaging Het
Tgfbr3l A G 8: 4,250,620 H266R possibly damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trip11 A G 12: 101,885,118 S896P probably damaging Het
Tubb6 T C 18: 67,392,976 V66A possibly damaging Het
Tyk2 A G 9: 21,105,107 L1189P probably damaging Het
Usp34 T G 11: 23,370,302 V911G Het
Wdr53 C T 16: 32,256,595 A206V probably damaging Het
Xrn1 A G 9: 96,038,928 E1364G probably benign Het
Ywhag T C 5: 135,911,363 M126V probably damaging Het
Zfp383 C T 7: 29,915,292 P324L probably damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9014:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGCAGCTGTATGTTATCCAG -3'
(R):5'- TTCATCACCCTCCGGATGTG -3'

Sequencing Primer
(F):5'- CAGCTGTATGTTATCCAGGAAGG -3'
(R):5'- TCACCCTCCGGATGTGGAATAAAG -3'
Posted On 2021-10-11