Mutagenetix > Incidental Mutation

Incidental Mutation 'R9013:Lrriq1'

685772

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R9013 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103215070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 607 (G607D)

Ref Sequence

ENSEMBL: ENSMUSP00000020043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000020043
AA Change: G607D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: G607D

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: G607D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: G607D

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	G	T	14: 70,156,727	L200I	probably damaging	Het
Afap1	G	A	5: 35,976,588	D456N	possibly damaging	Het
Afm	A	T	5: 90,523,735	D92V	probably damaging	Het
Ahi1	T	C	10: 21,007,759	I841T	probably benign	Het
Asb1	T	C	1: 91,552,441		probably null	Het
Astn1	A	T	1: 158,520,500	I507F	probably damaging	Het
Astn2	A	G	4: 65,992,347	M468T	probably benign	Het
C030006K11Rik	T	C	15: 76,723,804	S5G	probably benign	Het
C9	A	T	15: 6,486,712	D332V	probably damaging	Het
Cacna1c	A	T	6: 118,742,305	S423T	probably damaging	Het
Cbx8	T	C	11: 119,038,823	I315V	possibly damaging	Het
Ccdc50	T	A	16: 27,409,356	I91N	probably damaging	Het
Col4a1	T	A	8: 11,222,270	I707L	probably benign	Het
Cyc1	T	C	15: 76,344,819	V154A	possibly damaging	Het
Cyp4f40	A	T	17: 32,671,199	H281L	probably benign	Het
D130052B06Rik	T	G	11: 33,623,491	C74W	unknown	Het
Dap	G	A	15: 31,273,198	G66D	probably damaging	Het
Dclk3	A	T	9: 111,468,498	H370L	probably benign	Het
Dgka	C	A	10: 128,730,202	E360*	probably null	Het
Dst	A	G	1: 34,178,084	I1202V	possibly damaging	Het
Fzd10	C	G	5: 128,602,305	P363R	probably damaging	Het
Gm340	T	A	19: 41,584,750	V648D	probably damaging	Het
Gm4869	A	T	5: 140,463,613	Y180F	probably damaging	Het
Gm906	T	C	13: 50,247,552	H246R	possibly damaging	Het
Gpx2	A	G	12: 76,795,344	L11P	probably damaging	Het
Greb1	A	G	12: 16,739,969	L26S	probably damaging	Het
Gtpbp2	A	G	17: 46,164,814	K163R	probably benign	Het
Hsd3b1	A	T	3: 98,852,661	L338Q	probably damaging	Het
Il15ra	A	G	2: 11,727,765	S67G	probably benign	Het
Kcnc2	C	T	10: 112,271,818	A38V	probably damaging	Het
Klk1b16	A	G	7: 44,140,908	D169G	probably benign	Het
Kmt2a	T	C	9: 44,849,911	K214E	probably damaging	Het
Lysmd3	T	A	13: 81,669,461	S186T	probably damaging	Het
Meis1	G	T	11: 19,016,354	D6E	probably benign	Het
Mfsd4b2	T	G	10: 39,922,066	T98P	probably benign	Het
Muc16	T	A	9: 18,512,773	E8193V	possibly damaging	Het
Nr1i3	A	G	1: 171,214,457	T37A	probably damaging	Het
Nr5a2	A	T	1: 136,945,007	D112E	probably damaging	Het
Oas1c	A	G	5: 120,805,432	I214T	probably damaging	Het
Olfr109	G	A	17: 37,466,550	V115M	probably benign	Het
Olfr271-ps1	C	A	4: 52,935,900	A128S	probably benign	Het
Olfr482	A	G	7: 108,095,264	I102T	probably benign	Het
Olfr533	A	T	7: 140,466,266	R22W	probably benign	Het
Olfr800	T	C	10: 129,659,833	F9S	probably damaging	Het
Olfr834	A	T	9: 18,988,578	I197F	possibly damaging	Het
Omp	A	G	7: 98,145,345	M25T	probably benign	Het
Paf1	A	G	7: 28,398,708	E381G	unknown	Het
Pcdhga8	A	G	18: 37,725,944	T18A	probably benign	Het
Pclo	T	C	5: 14,677,613	S2162P	unknown	Het
Psg25	T	C	7: 18,524,765	I329V	probably benign	Het
Ptov1	A	G	7: 44,865,561	S209P	possibly damaging	Het
Ralgapb	A	G	2: 158,437,140	K397E	probably damaging	Het
Ryr2	T	A	13: 11,603,732	T3866S	probably damaging	Het
Sdccag8	G	A	1: 176,824,805	V41I	probably benign	Het
Sdf2l1	T	A	16: 17,130,766	D136V	possibly damaging	Het
Slc26a7	A	T	4: 14,506,514	S612T	probably damaging	Het
Snf8	T	C	11: 96,039,300	F43L	probably benign	Het
Snta1	A	T	2: 154,403,889	M104K	probably damaging	Het
Sox2	T	A	3: 34,650,597	M61K	probably damaging	Het
Spats2	T	A	15: 99,199,247	D293E	probably damaging	Het
Spta1	A	G	1: 174,222,608	D1738G	probably damaging	Het
Sqstm1	A	T	11: 50,207,857	Y89N	probably damaging	Het
Stat4	T	A	1: 52,011,798	N5K	probably benign	Het
Syne4	A	G	7: 30,317,993	H294R	probably damaging	Het
Tbc1d7	A	C	13: 43,168,834	F45V	probably damaging	Het
Tekt3	T	A	11: 63,083,858	N334K	probably damaging	Het
Tgfbr3l	A	G	8: 4,250,620	H266R	possibly damaging	Het
Trav7-6	A	G	14: 53,717,147	K65E	probably benign	Het
Trip11	A	G	12: 101,885,118	S896P	probably damaging	Het
Tubb6	T	C	18: 67,392,976	V66A	possibly damaging	Het
Tyk2	A	G	9: 21,105,107	L1189P	probably damaging	Het
Usp34	T	G	11: 23,370,302	V911G		Het
Wdr53	C	T	16: 32,256,595	A206V	probably damaging	Het
Xrn1	A	G	9: 96,038,928	E1364G	probably benign	Het
Ywhag	T	C	5: 135,911,363	M126V	probably damaging	Het
Zfp383	C	T	7: 29,915,292	P324L	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGCAGCATCACAGGACAG -3'
(R):5'- GAATGAACAGTACCCGTGGC -3'

Sequencing Primer
(F):5'- AGGACAGCACACCTTCTTCTGG -3'
(R):5'- TACCCGTGGCAAGGACTAG -3'

Posted On

2021-10-11