Incidental Mutation 'R9014:Casq1'
ID 685811
Institutional Source Beutler Lab
Gene Symbol Casq1
Ensembl Gene ENSMUSG00000007122
Gene Name calsequestrin 1
Synonyms CSQ-1, CSQ1, CSQ, sCSQ
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 172209894-172219868 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 172210497 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 356 (S356C)
Ref Sequence ENSEMBL: ENSMUSP00000003554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000013842] [ENSMUST00000111247] [ENSMUST00000155109] [ENSMUST00000170700]
AlphaFold O09165
Predicted Effect probably damaging
Transcript: ENSMUST00000003554
AA Change: S356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: S356C

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 402 5.3e-238 PFAM
Pfam:Thioredoxin_6 186 379 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013842
SMART Domains Protein: ENSMUSP00000013842
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111247
SMART Domains Protein: ENSMUSP00000106878
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 59 9.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155109
SMART Domains Protein: ENSMUSP00000117735
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170700
SMART Domains Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 94 9.7e-38 PFAM
Pfam:Calsequestrin 89 156 6.9e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,662 L649P possibly damaging Het
9530053A07Rik A G 7: 28,155,451 E1834G probably damaging Het
Aco2 A G 15: 81,914,656 N746S probably benign Het
Ahnak2 T C 12: 112,773,736 T1301A possibly damaging Het
Akap6 T A 12: 53,139,620 N1272K possibly damaging Het
Apc G T 18: 34,221,021 probably benign Het
Arap1 A G 7: 101,404,333 S1290G probably damaging Het
Arhgef25 T C 10: 127,183,738 Y483C probably damaging Het
Arpp21 G T 9: 112,177,728 Q138K probably damaging Het
Bahcc1 C T 11: 120,272,889 A671V probably benign Het
Bahcc1 T C 11: 120,282,222 S1557P probably benign Het
Brca2 C A 5: 150,541,754 T1661K probably benign Het
Catsperg1 T C 7: 29,206,641 Y171C probably damaging Het
Ccdc88c G C 12: 100,913,064 Q1926E probably benign Het
Cdc42bpg T A 19: 6,322,259 M1425K possibly damaging Het
Chac2 C T 11: 30,986,158 R30Q probably damaging Het
Clca3a1 T C 3: 144,736,970 D771G probably benign Het
Cyp26c1 T C 19: 37,687,396 probably null Het
Dcaf8 T C 1: 172,179,963 V333A possibly damaging Het
Dennd4c G A 4: 86,821,465 S997N probably benign Het
Dennd4c A C 4: 86,836,429 I1559L probably benign Het
Dgcr8 T G 16: 18,259,650 H632P possibly damaging Het
Dhx16 C A 17: 35,882,598 R278S probably benign Het
Dsel A T 1: 111,860,779 Y675* probably null Het
Dsp T C 13: 38,192,724 I1495T possibly damaging Het
Fam227a T A 15: 79,620,757 N495I possibly damaging Het
Focad T A 4: 88,357,526 M1124K unknown Het
Foxi3 A G 6: 70,960,831 H349R probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Fsip2 C A 2: 82,976,554 D1072E probably benign Het
Fsip2 T G 2: 82,986,731 H4269Q possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gm49383 A C 12: 69,196,651 Y151* probably null Het
Ighv1-26 T A 12: 114,788,413 S104C probably damaging Het
Kat6a A G 8: 22,940,071 N1814S unknown Het
Kif18a T A 2: 109,293,069 H229Q probably damaging Het
Klk1b4 C T 7: 44,209,674 R39C probably benign Het
Lgr6 T C 1: 135,003,510 I269V probably damaging Het
Lrtm2 A G 6: 119,317,258 V304A probably damaging Het
Lsm8 A G 6: 18,853,633 D78G possibly damaging Het
Mroh2b T C 15: 4,899,188 M1T probably null Het
Ms4a14 T C 19: 11,301,507 E1229G possibly damaging Het
Nbeal1 G A 1: 60,289,959 D2179N probably damaging Het
Nfix G A 8: 84,721,776 T366M possibly damaging Het
Olfr1099 T A 2: 86,958,691 I256F probably benign Het
Olfr504 A G 7: 108,565,675 L40P possibly damaging Het
Olfr533 A T 7: 140,465,970 probably benign Het
Olfr913 T C 9: 38,594,827 V202A probably damaging Het
Pear1 T C 3: 87,751,172 Q964R probably benign Het
Pgk2 T G 17: 40,207,796 E247A probably benign Het
Ppfia2 C T 10: 106,927,805 P1220S probably benign Het
Ppp1r1b T C 11: 98,350,623 S46P probably damaging Het
Ppp2ca C A 11: 52,118,683 H167Q probably damaging Het
Scel A T 14: 103,585,139 R396S probably benign Het
Siae T C 9: 37,646,343 V482A possibly damaging Het
Skint2 A G 4: 112,625,829 M144V probably benign Het
Slc23a3 A G 1: 75,132,630 F219L probably benign Het
Slc4a4 G T 5: 89,132,386 A348S probably damaging Het
Spin1 G T 13: 51,127,974 probably null Het
Tab2 G A 10: 7,919,156 R521W probably damaging Het
Tas2r118 G A 6: 23,970,050 T4M probably benign Het
Tet2 T A 3: 133,467,188 D1771V probably damaging Het
Tmprss15 T C 16: 79,075,803 T172A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Txnrd3 A G 6: 89,654,109 Y129C probably damaging Het
Ulk4 A G 9: 121,188,228 I728T probably benign Het
Vmn1r44 G A 6: 89,894,015 V248M possibly damaging Het
Wdr64 A G 1: 175,698,829 I15V probably benign Het
Zdhhc17 T C 10: 110,949,683 T423A probably benign Het
Zfp619 T C 7: 39,537,822 I1092T probably benign Het
Zfp729b A T 13: 67,592,155 Y664N probably damaging Het
Other mutations in Casq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Casq1 APN 1 172213381 missense probably damaging 0.96
IGL02699:Casq1 APN 1 172219696 start gained probably benign
IGL02756:Casq1 APN 1 172215105 missense probably damaging 1.00
PIT4377001:Casq1 UTSW 1 172212001 missense probably benign 0.15
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0124:Casq1 UTSW 1 172210425 missense probably damaging 1.00
R0485:Casq1 UTSW 1 172210390 unclassified probably benign
R1982:Casq1 UTSW 1 172215530 missense probably damaging 1.00
R2095:Casq1 UTSW 1 172215962 missense probably benign 0.26
R2097:Casq1 UTSW 1 172210421 missense probably damaging 1.00
R3940:Casq1 UTSW 1 172219536 missense possibly damaging 0.91
R4654:Casq1 UTSW 1 172210398 unclassified probably benign
R4790:Casq1 UTSW 1 172216837 missense probably damaging 1.00
R5002:Casq1 UTSW 1 172213378 missense possibly damaging 0.50
R5187:Casq1 UTSW 1 172213074 missense possibly damaging 0.54
R5307:Casq1 UTSW 1 172219416 missense probably damaging 1.00
R5973:Casq1 UTSW 1 172219501 missense probably damaging 1.00
R6251:Casq1 UTSW 1 172216840 missense probably benign 0.17
R6768:Casq1 UTSW 1 172219678 missense probably benign 0.04
R7380:Casq1 UTSW 1 172216849 missense probably benign 0.07
R9292:Casq1 UTSW 1 172215547 missense probably damaging 1.00
Z1176:Casq1 UTSW 1 172215914 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACCTAGTGTCCCAAGGAG -3'
(R):5'- TCACCATTCTAACGCCGATC -3'

Sequencing Primer
(F):5'- TAGTGTCCCAAGGAGCCCAG -3'
(R):5'- GCCGATCTTCACCGGGATAG -3'
Posted On 2021-10-11