Incidental Mutation 'R9014:Fzd10'
ID 685825
Institutional Source Beutler Lab
Gene Symbol Fzd10
Ensembl Gene ENSMUSG00000081683
Gene Name frizzled class receptor 10
Synonyms Fz-10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 128600844-128604093 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 128602305 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 363 (P363R)
Ref Sequence ENSEMBL: ENSMUSP00000114114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117102]
AlphaFold Q8BKG4
Predicted Effect probably damaging
Transcript: ENSMUST00000117102
AA Change: P363R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114114
Gene: ENSMUSG00000081683
AA Change: P363R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FRI 34 153 7.83e-68 SMART
Frizzled 218 542 2.62e-207 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the frizzled gene family. Members of this family encode 7-transmembrane domain proteins that are receptors for the Wingless type MMTV integration site family of signaling proteins. Most frizzled receptors are coupled to the beta-catenin canonical signaling pathway. Using array analysis, expression of this intronless gene is significantly up-regulated in two cases of primary colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,662 L649P possibly damaging Het
9530053A07Rik A G 7: 28,155,451 E1834G probably damaging Het
Aco2 A G 15: 81,914,656 N746S probably benign Het
Ahnak2 T C 12: 112,773,736 T1301A possibly damaging Het
Akap6 T A 12: 53,139,620 N1272K possibly damaging Het
Apc G T 18: 34,221,021 probably benign Het
Arap1 A G 7: 101,404,333 S1290G probably damaging Het
Arhgef25 T C 10: 127,183,738 Y483C probably damaging Het
Arpp21 G T 9: 112,177,728 Q138K probably damaging Het
Bahcc1 C T 11: 120,272,889 A671V probably benign Het
Bahcc1 T C 11: 120,282,222 S1557P probably benign Het
Brca2 C A 5: 150,541,754 T1661K probably benign Het
Casq1 T A 1: 172,210,497 S356C probably damaging Het
Catsperg1 T C 7: 29,206,641 Y171C probably damaging Het
Ccdc88c G C 12: 100,913,064 Q1926E probably benign Het
Cdc42bpg T A 19: 6,322,259 M1425K possibly damaging Het
Chac2 C T 11: 30,986,158 R30Q probably damaging Het
Clca3a1 T C 3: 144,736,970 D771G probably benign Het
Cyp26c1 T C 19: 37,687,396 probably null Het
Dcaf8 T C 1: 172,179,963 V333A possibly damaging Het
Dennd4c G A 4: 86,821,465 S997N probably benign Het
Dennd4c A C 4: 86,836,429 I1559L probably benign Het
Dgcr8 T G 16: 18,259,650 H632P possibly damaging Het
Dhx16 C A 17: 35,882,598 R278S probably benign Het
Dsel A T 1: 111,860,779 Y675* probably null Het
Dsp T C 13: 38,192,724 I1495T possibly damaging Het
Fam227a T A 15: 79,620,757 N495I possibly damaging Het
Focad T A 4: 88,357,526 M1124K unknown Het
Foxi3 A G 6: 70,960,831 H349R probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Fsip2 C A 2: 82,976,554 D1072E probably benign Het
Fsip2 T G 2: 82,986,731 H4269Q possibly damaging Het
Gm49383 A C 12: 69,196,651 Y151* probably null Het
Ighv1-26 T A 12: 114,788,413 S104C probably damaging Het
Kat6a A G 8: 22,940,071 N1814S unknown Het
Kif18a T A 2: 109,293,069 H229Q probably damaging Het
Klk1b4 C T 7: 44,209,674 R39C probably benign Het
Lgr6 T C 1: 135,003,510 I269V probably damaging Het
Lrtm2 A G 6: 119,317,258 V304A probably damaging Het
Lsm8 A G 6: 18,853,633 D78G possibly damaging Het
Mroh2b T C 15: 4,899,188 M1T probably null Het
Ms4a14 T C 19: 11,301,507 E1229G possibly damaging Het
Nbeal1 G A 1: 60,289,959 D2179N probably damaging Het
Nfix G A 8: 84,721,776 T366M possibly damaging Het
Olfr1099 T A 2: 86,958,691 I256F probably benign Het
Olfr504 A G 7: 108,565,675 L40P possibly damaging Het
Olfr533 A T 7: 140,465,970 probably benign Het
Olfr913 T C 9: 38,594,827 V202A probably damaging Het
Pear1 T C 3: 87,751,172 Q964R probably benign Het
Pgk2 T G 17: 40,207,796 E247A probably benign Het
Ppfia2 C T 10: 106,927,805 P1220S probably benign Het
Ppp1r1b T C 11: 98,350,623 S46P probably damaging Het
Ppp2ca C A 11: 52,118,683 H167Q probably damaging Het
Scel A T 14: 103,585,139 R396S probably benign Het
Siae T C 9: 37,646,343 V482A possibly damaging Het
Skint2 A G 4: 112,625,829 M144V probably benign Het
Slc23a3 A G 1: 75,132,630 F219L probably benign Het
Slc4a4 G T 5: 89,132,386 A348S probably damaging Het
Spin1 G T 13: 51,127,974 probably null Het
Tab2 G A 10: 7,919,156 R521W probably damaging Het
Tas2r118 G A 6: 23,970,050 T4M probably benign Het
Tet2 T A 3: 133,467,188 D1771V probably damaging Het
Tmprss15 T C 16: 79,075,803 T172A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Txnrd3 A G 6: 89,654,109 Y129C probably damaging Het
Ulk4 A G 9: 121,188,228 I728T probably benign Het
Vmn1r44 G A 6: 89,894,015 V248M possibly damaging Het
Wdr64 A G 1: 175,698,829 I15V probably benign Het
Zdhhc17 T C 10: 110,949,683 T423A probably benign Het
Zfp619 T C 7: 39,537,822 I1092T probably benign Het
Zfp729b A T 13: 67,592,155 Y664N probably damaging Het
Other mutations in Fzd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Fzd10 APN 5 128601528 missense probably damaging 1.00
IGL02354:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL02361:Fzd10 APN 5 128601868 missense possibly damaging 0.89
IGL03088:Fzd10 APN 5 128602605 missense possibly damaging 0.81
R0530:Fzd10 UTSW 5 128602013 missense probably damaging 1.00
R0645:Fzd10 UTSW 5 128602598 missense possibly damaging 0.94
R1515:Fzd10 UTSW 5 128602559 missense probably damaging 1.00
R3930:Fzd10 UTSW 5 128602412 missense probably damaging 1.00
R4467:Fzd10 UTSW 5 128601276 missense probably benign 0.01
R4976:Fzd10 UTSW 5 128602114 nonsense probably null
R5156:Fzd10 UTSW 5 128601302 missense possibly damaging 0.68
R5202:Fzd10 UTSW 5 128602116 missense possibly damaging 0.78
R5874:Fzd10 UTSW 5 128601300 missense probably benign 0.41
R6238:Fzd10 UTSW 5 128602931 missense probably damaging 0.99
R6921:Fzd10 UTSW 5 128601582 missense probably damaging 0.99
R7684:Fzd10 UTSW 5 128601416 missense possibly damaging 0.73
R8093:Fzd10 UTSW 5 128602239 missense probably benign 0.14
R9011:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9013:Fzd10 UTSW 5 128602305 missense probably damaging 1.00
R9332:Fzd10 UTSW 5 128601252 missense possibly damaging 0.92
Z1088:Fzd10 UTSW 5 128601246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCAGCTGTATGTTATCCAGG -3'
(R):5'- TTCATCACCCTCCGGATGTG -3'

Sequencing Primer
(F):5'- CAGGAAGGACTGGAGAGCAC -3'
(R):5'- TCACCCTCCGGATGTGGAATAAAG -3'
Posted On 2021-10-11