Incidental Mutation 'R9014:Ulk4'
ID 685846
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R9014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120955351-121277197 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121188228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 728 (I728T)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051479
AA Change: I728T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: I728T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably benign
Transcript: ENSMUST00000171061
AA Change: I728T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: I728T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171923
AA Change: I728T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: I728T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,662 L649P possibly damaging Het
9530053A07Rik A G 7: 28,155,451 E1834G probably damaging Het
Aco2 A G 15: 81,914,656 N746S probably benign Het
Ahnak2 T C 12: 112,773,736 T1301A possibly damaging Het
Akap6 T A 12: 53,139,620 N1272K possibly damaging Het
Apc G T 18: 34,221,021 probably benign Het
Arap1 A G 7: 101,404,333 S1290G probably damaging Het
Arhgef25 T C 10: 127,183,738 Y483C probably damaging Het
Arpp21 G T 9: 112,177,728 Q138K probably damaging Het
Bahcc1 C T 11: 120,272,889 A671V probably benign Het
Bahcc1 T C 11: 120,282,222 S1557P probably benign Het
Brca2 C A 5: 150,541,754 T1661K probably benign Het
Casq1 T A 1: 172,210,497 S356C probably damaging Het
Catsperg1 T C 7: 29,206,641 Y171C probably damaging Het
Ccdc88c G C 12: 100,913,064 Q1926E probably benign Het
Cdc42bpg T A 19: 6,322,259 M1425K possibly damaging Het
Chac2 C T 11: 30,986,158 R30Q probably damaging Het
Clca3a1 T C 3: 144,736,970 D771G probably benign Het
Cyp26c1 T C 19: 37,687,396 probably null Het
Dcaf8 T C 1: 172,179,963 V333A possibly damaging Het
Dennd4c G A 4: 86,821,465 S997N probably benign Het
Dennd4c A C 4: 86,836,429 I1559L probably benign Het
Dgcr8 T G 16: 18,259,650 H632P possibly damaging Het
Dhx16 C A 17: 35,882,598 R278S probably benign Het
Dsel A T 1: 111,860,779 Y675* probably null Het
Dsp T C 13: 38,192,724 I1495T possibly damaging Het
Fam227a T A 15: 79,620,757 N495I possibly damaging Het
Focad T A 4: 88,357,526 M1124K unknown Het
Foxi3 A G 6: 70,960,831 H349R probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Fsip2 C A 2: 82,976,554 D1072E probably benign Het
Fsip2 T G 2: 82,986,731 H4269Q possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gm49383 A C 12: 69,196,651 Y151* probably null Het
Ighv1-26 T A 12: 114,788,413 S104C probably damaging Het
Kat6a A G 8: 22,940,071 N1814S unknown Het
Kif18a T A 2: 109,293,069 H229Q probably damaging Het
Klk1b4 C T 7: 44,209,674 R39C probably benign Het
Lgr6 T C 1: 135,003,510 I269V probably damaging Het
Lrtm2 A G 6: 119,317,258 V304A probably damaging Het
Lsm8 A G 6: 18,853,633 D78G possibly damaging Het
Mroh2b T C 15: 4,899,188 M1T probably null Het
Ms4a14 T C 19: 11,301,507 E1229G possibly damaging Het
Nbeal1 G A 1: 60,289,959 D2179N probably damaging Het
Nfix G A 8: 84,721,776 T366M possibly damaging Het
Olfr1099 T A 2: 86,958,691 I256F probably benign Het
Olfr504 A G 7: 108,565,675 L40P possibly damaging Het
Olfr533 A T 7: 140,465,970 probably benign Het
Olfr913 T C 9: 38,594,827 V202A probably damaging Het
Pear1 T C 3: 87,751,172 Q964R probably benign Het
Pgk2 T G 17: 40,207,796 E247A probably benign Het
Ppfia2 C T 10: 106,927,805 P1220S probably benign Het
Ppp1r1b T C 11: 98,350,623 S46P probably damaging Het
Ppp2ca C A 11: 52,118,683 H167Q probably damaging Het
Scel A T 14: 103,585,139 R396S probably benign Het
Siae T C 9: 37,646,343 V482A possibly damaging Het
Skint2 A G 4: 112,625,829 M144V probably benign Het
Slc23a3 A G 1: 75,132,630 F219L probably benign Het
Slc4a4 G T 5: 89,132,386 A348S probably damaging Het
Spin1 G T 13: 51,127,974 probably null Het
Tab2 G A 10: 7,919,156 R521W probably damaging Het
Tas2r118 G A 6: 23,970,050 T4M probably benign Het
Tet2 T A 3: 133,467,188 D1771V probably damaging Het
Tmprss15 T C 16: 79,075,803 T172A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Txnrd3 A G 6: 89,654,109 Y129C probably damaging Het
Vmn1r44 G A 6: 89,894,015 V248M possibly damaging Het
Wdr64 A G 1: 175,698,829 I15V probably benign Het
Zdhhc17 T C 10: 110,949,683 T423A probably benign Het
Zfp619 T C 7: 39,537,822 I1092T probably benign Het
Zfp729b A T 13: 67,592,155 Y664N probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
R8841:Ulk4 UTSW 9 121204738 missense probably damaging 1.00
R9092:Ulk4 UTSW 9 121073937 missense
R9126:Ulk4 UTSW 9 121261922 missense probably damaging 0.99
R9176:Ulk4 UTSW 9 121145062 missense probably benign
R9235:Ulk4 UTSW 9 121152151 missense probably benign 0.13
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATTTCTCCTCGTTACCAGGAG -3'
(R):5'- GAAAGATCTGTGCTCCTGCTC -3'

Sequencing Primer
(F):5'- CTCGTTACCAGGAGACAGCAG -3'
(R):5'- TGCTCTCACAGGCCCTG -3'
Posted On 2021-10-11