Incidental Mutation 'R9014:Scel'
ID 685866
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103585139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 396 (R396S)
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: R396S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: R396S

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: R376S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,662 L649P possibly damaging Het
9530053A07Rik A G 7: 28,155,451 E1834G probably damaging Het
Aco2 A G 15: 81,914,656 N746S probably benign Het
Ahnak2 T C 12: 112,773,736 T1301A possibly damaging Het
Akap6 T A 12: 53,139,620 N1272K possibly damaging Het
Apc G T 18: 34,221,021 probably benign Het
Arap1 A G 7: 101,404,333 S1290G probably damaging Het
Arhgef25 T C 10: 127,183,738 Y483C probably damaging Het
Arpp21 G T 9: 112,177,728 Q138K probably damaging Het
Bahcc1 C T 11: 120,272,889 A671V probably benign Het
Bahcc1 T C 11: 120,282,222 S1557P probably benign Het
Brca2 C A 5: 150,541,754 T1661K probably benign Het
Casq1 T A 1: 172,210,497 S356C probably damaging Het
Catsperg1 T C 7: 29,206,641 Y171C probably damaging Het
Ccdc88c G C 12: 100,913,064 Q1926E probably benign Het
Cdc42bpg T A 19: 6,322,259 M1425K possibly damaging Het
Chac2 C T 11: 30,986,158 R30Q probably damaging Het
Clca3a1 T C 3: 144,736,970 D771G probably benign Het
Cyp26c1 T C 19: 37,687,396 probably null Het
Dcaf8 T C 1: 172,179,963 V333A possibly damaging Het
Dennd4c G A 4: 86,821,465 S997N probably benign Het
Dennd4c A C 4: 86,836,429 I1559L probably benign Het
Dgcr8 T G 16: 18,259,650 H632P possibly damaging Het
Dhx16 C A 17: 35,882,598 R278S probably benign Het
Dsel A T 1: 111,860,779 Y675* probably null Het
Dsp T C 13: 38,192,724 I1495T possibly damaging Het
Fam227a T A 15: 79,620,757 N495I possibly damaging Het
Focad T A 4: 88,357,526 M1124K unknown Het
Foxi3 A G 6: 70,960,831 H349R probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Fsip2 C A 2: 82,976,554 D1072E probably benign Het
Fsip2 T G 2: 82,986,731 H4269Q possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gm49383 A C 12: 69,196,651 Y151* probably null Het
Ighv1-26 T A 12: 114,788,413 S104C probably damaging Het
Kat6a A G 8: 22,940,071 N1814S unknown Het
Kif18a T A 2: 109,293,069 H229Q probably damaging Het
Klk1b4 C T 7: 44,209,674 R39C probably benign Het
Lgr6 T C 1: 135,003,510 I269V probably damaging Het
Lrtm2 A G 6: 119,317,258 V304A probably damaging Het
Lsm8 A G 6: 18,853,633 D78G possibly damaging Het
Mroh2b T C 15: 4,899,188 M1T probably null Het
Ms4a14 T C 19: 11,301,507 E1229G possibly damaging Het
Nbeal1 G A 1: 60,289,959 D2179N probably damaging Het
Nfix G A 8: 84,721,776 T366M possibly damaging Het
Olfr1099 T A 2: 86,958,691 I256F probably benign Het
Olfr504 A G 7: 108,565,675 L40P possibly damaging Het
Olfr533 A T 7: 140,465,970 probably benign Het
Olfr913 T C 9: 38,594,827 V202A probably damaging Het
Pear1 T C 3: 87,751,172 Q964R probably benign Het
Pgk2 T G 17: 40,207,796 E247A probably benign Het
Ppfia2 C T 10: 106,927,805 P1220S probably benign Het
Ppp1r1b T C 11: 98,350,623 S46P probably damaging Het
Ppp2ca C A 11: 52,118,683 H167Q probably damaging Het
Siae T C 9: 37,646,343 V482A possibly damaging Het
Skint2 A G 4: 112,625,829 M144V probably benign Het
Slc23a3 A G 1: 75,132,630 F219L probably benign Het
Slc4a4 G T 5: 89,132,386 A348S probably damaging Het
Spin1 G T 13: 51,127,974 probably null Het
Tab2 G A 10: 7,919,156 R521W probably damaging Het
Tas2r118 G A 6: 23,970,050 T4M probably benign Het
Tet2 T A 3: 133,467,188 D1771V probably damaging Het
Tmprss15 T C 16: 79,075,803 T172A probably benign Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Txnrd3 A G 6: 89,654,109 Y129C probably damaging Het
Ulk4 A G 9: 121,188,228 I728T probably benign Het
Vmn1r44 G A 6: 89,894,015 V248M possibly damaging Het
Wdr64 A G 1: 175,698,829 I15V probably benign Het
Zdhhc17 T C 10: 110,949,683 T423A probably benign Het
Zfp619 T C 7: 39,537,822 I1092T probably benign Het
Zfp729b A T 13: 67,592,155 Y664N probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGGATTCAAGTCATGCTGGAG -3'
(R):5'- CGTGTATGATTATGGTGTCACAAG -3'

Sequencing Primer
(F):5'- CAAGTCATGCTGGAGTTTTGAATTAC -3'
(R):5'- GGTGTCACAAGAAATTTCTCAAGTAG -3'
Posted On 2021-10-11