Incidental Mutation 'R9015:Vwa3b'
ID 685880
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Name von Willebrand factor A domain containing 3B
Synonyms 4921511C04Rik, A230074B11Rik
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 37026596-37187613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37164516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 59 (V59I)
Ref Sequence ENSEMBL: ENSMUSP00000132886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289] [ENSMUST00000169057]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169057
AA Change: V59I

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,232,610 D335G probably damaging Het
AI413582 T C 17: 27,564,249 D48G probably benign Het
Alas1 A T 9: 106,236,471 I525N probably benign Het
Aox2 G A 1: 58,343,692 V1044M probably damaging Het
Apcdd1 A T 18: 62,950,086 Y329F possibly damaging Het
Arhgap10 A C 8: 77,259,058 C727G probably benign Het
Arid4a G A 12: 71,075,394 D528N possibly damaging Het
Atp8a1 A G 5: 67,729,907 V611A Het
BC004004 T C 17: 29,298,663 F284L probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep295 T C 9: 15,332,968 I1397M probably benign Het
Cep63 A G 9: 102,618,912 S99P probably damaging Het
Coq3 T A 4: 21,899,107 S147T probably benign Het
Crym A T 7: 120,201,867 S20T probably benign Het
Ctr9 T A 7: 111,043,901 N493K probably benign Het
Dchs2 A G 3: 83,281,444 I1372V possibly damaging Het
Ddi2 G A 4: 141,685,436 T55M probably benign Het
Dnah1 T C 14: 31,264,359 M3724V probably damaging Het
Dst A G 1: 34,287,256 I4690V probably benign Het
Ect2l T C 10: 18,163,400 T429A probably benign Het
Eif3c G T 7: 126,556,366 H577N probably damaging Het
Erg A G 16: 95,361,267 S334P possibly damaging Het
Faf2 A G 13: 54,648,326 S127G probably benign Het
Fbxl3 T A 14: 103,092,354 T141S possibly damaging Het
Fbxw4 T A 19: 45,636,435 M122L probably benign Het
Fgd4 T C 16: 16,454,077 M476V probably damaging Het
Flvcr2 A T 12: 85,783,005 I263F probably benign Het
Gadl1 A T 9: 115,965,637 R293S probably benign Het
Gm11983 G T 11: 6,837,033 F31L unknown Het
Gmnn A T 13: 24,756,655 N70K probably benign Het
Gpr3 A G 4: 133,211,079 V94A possibly damaging Het
Greb1l A G 18: 10,541,675 S1141G probably benign Het
Helz2 A T 2: 181,228,999 V2892E probably damaging Het
Hivep1 T A 13: 42,158,373 M1363K probably benign Het
Hk1 T A 10: 62,292,339 T336S possibly damaging Het
Hpgds A T 6: 65,138,245 I18N possibly damaging Het
Insrr T A 3: 87,813,603 L1056Q probably damaging Het
Ints10 A G 8: 68,807,487 M288V probably benign Het
Itgb6 T C 2: 60,654,688 D237G probably damaging Het
Kcnf1 A G 12: 17,175,302 I306T probably damaging Het
Kdm3b G A 18: 34,830,159 G1556D probably damaging Het
Kif5b A G 18: 6,216,892 L477P probably damaging Het
Klf5 T G 14: 99,303,483 *310G probably null Het
Lnx1 A G 5: 74,620,122 V246A probably benign Het
Ly75 C T 2: 60,316,098 E1279K probably benign Het
Lztr1 T A 16: 17,519,441 C233S probably benign Het
Mfsd6l T G 11: 68,556,710 I129S probably benign Het
Mrgprx2 T A 7: 48,499,190 probably benign Het
Olfr1115 T A 2: 87,252,202 Y88* probably null Het
Olfr1121 T A 2: 87,372,141 M203K possibly damaging Het
Olfr447 G T 6: 42,911,891 V123L possibly damaging Het
Olfr948 A C 9: 39,318,723 V297G probably damaging Het
Pde6a A G 18: 61,263,976 H631R probably damaging Het
Pfkl C T 10: 77,988,960 G665D probably damaging Het
Pik3ap1 T A 19: 41,281,991 E753V probably damaging Het
Pik3cd G T 4: 149,655,598 R502S probably benign Het
Piwil2 T A 14: 70,390,535 I762L probably benign Het
Pkd1 T A 17: 24,565,662 L394* probably null Het
Plekhb2 A G 1: 34,876,965 D195G probably benign Het
Plppr5 T C 3: 117,662,454 M208T probably damaging Het
Polr2i G A 7: 30,233,088 V115I unknown Het
Prkacb T C 3: 146,750,484 S187G probably null Het
Prkag3 G T 1: 74,741,194 H437Q probably benign Het
Prlr T A 15: 10,319,266 Y94N probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psd4 A G 2: 24,397,480 R475G Het
Rad51b G A 12: 79,300,643 C27Y probably damaging Het
Scfd2 A G 5: 74,530,964 L219P probably damaging Het
Scn5a G A 9: 119,552,076 probably benign Het
Sec24d T C 3: 123,327,638 V391A probably benign Het
Selenbp2 T A 3: 94,700,025 L251Q probably damaging Het
Sh3rf1 T C 8: 61,374,168 V652A probably benign Het
Slc11a2 A G 15: 100,403,305 V289A probably benign Het
Sox8 T A 17: 25,570,161 Y121F probably damaging Het
Taar7a A T 10: 23,992,835 I216N probably damaging Het
Tanc1 T A 2: 59,791,880 S448T probably benign Het
Tas2r119 G A 15: 32,178,080 G264D probably damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trim17 A G 11: 58,965,231 E38G probably damaging Het
Ttn T A 2: 76,741,620 M26310L probably damaging Het
Unc13c T G 9: 73,546,040 I1823L probably benign Het
Vav2 C A 2: 27,270,139 E728* probably null Het
Virma A G 4: 11,540,494 D1465G probably benign Het
Vmn2r72 T G 7: 85,749,180 M531L probably benign Het
Xrcc1 G A 7: 24,572,217 E542K probably benign Het
Zdhhc6 T G 19: 55,298,886 T381P probably benign Het
Zdhhc8 T C 16: 18,223,277 S740G probably damaging Het
Zfp106 T C 2: 120,533,538 K819R probably damaging Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4897:Vwa3b UTSW 1 37114603 splice site probably benign
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
R9263:Vwa3b UTSW 1 37060412 missense probably benign 0.43
R9277:Vwa3b UTSW 1 37157453 critical splice donor site probably null
R9294:Vwa3b UTSW 1 37035801 missense probably damaging 0.99
R9341:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
R9343:Vwa3b UTSW 1 37114534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTATGTGACCTCTAAGTC -3'
(R):5'- AGAACCTCTGGAGAGCACAC -3'

Sequencing Primer
(F):5'- CCATTTAGGGGTCACAAATCAG -3'
(R):5'- GACAGACTCAGAAGTGCTACTTGTC -3'
Posted On 2021-10-11