Incidental Mutation 'R9015:Insrr'
ID 685894
Institutional Source Beutler Lab
Gene Symbol Insrr
Ensembl Gene ENSMUSG00000005640
Gene Name insulin receptor-related receptor
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock # R9015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 87796951-87816101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87813603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1056 (L1056Q)
Ref Sequence ENSEMBL: ENSMUSP00000029711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]
AlphaFold Q9WTL4
Predicted Effect probably damaging
Transcript: ENSMUST00000029711
AA Change: L1056Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: L1056Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 1.8e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 3.8e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029714
SMART Domains Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090981
SMART Domains Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
EGF 102 130 3.82e-2 SMART
EGF_like 132 173 2.92e1 SMART
EGF_like 146 185 1.92e0 SMART
EGF_like 189 246 1.99e0 SMART
EGF 217 258 1.04e1 SMART
EGF_Lam 274 313 1.21e-4 SMART
EGF 312 344 4.03e-1 SMART
EGF_Lam 361 402 1.33e-1 SMART
EGF 401 433 1.18e-2 SMART
EGF_like 449 488 1.72e0 SMART
EGF 487 519 6.92e0 SMART
EGF_Lam 535 574 2.08e-3 SMART
EGF 573 605 5.49e-3 SMART
EGF_Lam 620 660 1.58e-3 SMART
EGF 659 691 3.1e-2 SMART
EGF 702 734 2.53e1 SMART
transmembrane domain 754 776 N/A INTRINSIC
low complexity region 809 822 N/A INTRINSIC
low complexity region 829 835 N/A INTRINSIC
low complexity region 954 971 N/A INTRINSIC
low complexity region 993 1002 N/A INTRINSIC
low complexity region 1019 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107582
AA Change: L1056Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: L1056Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Recep_L_domain 47 159 7.7e-25 PFAM
FU 225 268 9.54e-11 SMART
Pfam:Recep_L_domain 346 460 1.6e-28 PFAM
FN3 483 586 9.19e-1 SMART
FN3 605 798 6.45e-5 SMART
FN3 816 899 6.35e-4 SMART
TyrKc 979 1246 4.61e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,232,610 D335G probably damaging Het
AI413582 T C 17: 27,564,249 D48G probably benign Het
Alas1 A T 9: 106,236,471 I525N probably benign Het
Aox2 G A 1: 58,343,692 V1044M probably damaging Het
Apcdd1 A T 18: 62,950,086 Y329F possibly damaging Het
Arhgap10 A C 8: 77,259,058 C727G probably benign Het
Arid4a G A 12: 71,075,394 D528N possibly damaging Het
Atp8a1 A G 5: 67,729,907 V611A Het
BC004004 T C 17: 29,298,663 F284L probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep295 T C 9: 15,332,968 I1397M probably benign Het
Cep63 A G 9: 102,618,912 S99P probably damaging Het
Coq3 T A 4: 21,899,107 S147T probably benign Het
Crym A T 7: 120,201,867 S20T probably benign Het
Ctr9 T A 7: 111,043,901 N493K probably benign Het
Dchs2 A G 3: 83,281,444 I1372V possibly damaging Het
Ddi2 G A 4: 141,685,436 T55M probably benign Het
Dnah1 T C 14: 31,264,359 M3724V probably damaging Het
Dst A G 1: 34,287,256 I4690V probably benign Het
Ect2l T C 10: 18,163,400 T429A probably benign Het
Eif3c G T 7: 126,556,366 H577N probably damaging Het
Erg A G 16: 95,361,267 S334P possibly damaging Het
Faf2 A G 13: 54,648,326 S127G probably benign Het
Fbxl3 T A 14: 103,092,354 T141S possibly damaging Het
Fbxw4 T A 19: 45,636,435 M122L probably benign Het
Fgd4 T C 16: 16,454,077 M476V probably damaging Het
Flvcr2 A T 12: 85,783,005 I263F probably benign Het
Gadl1 A T 9: 115,965,637 R293S probably benign Het
Gm11983 G T 11: 6,837,033 F31L unknown Het
Gmnn A T 13: 24,756,655 N70K probably benign Het
Gpr3 A G 4: 133,211,079 V94A possibly damaging Het
Greb1l A G 18: 10,541,675 S1141G probably benign Het
Helz2 A T 2: 181,228,999 V2892E probably damaging Het
Hivep1 T A 13: 42,158,373 M1363K probably benign Het
Hk1 T A 10: 62,292,339 T336S possibly damaging Het
Hpgds A T 6: 65,138,245 I18N possibly damaging Het
Ints10 A G 8: 68,807,487 M288V probably benign Het
Itgb6 T C 2: 60,654,688 D237G probably damaging Het
Kcnf1 A G 12: 17,175,302 I306T probably damaging Het
Kdm3b G A 18: 34,830,159 G1556D probably damaging Het
Kif5b A G 18: 6,216,892 L477P probably damaging Het
Klf5 T G 14: 99,303,483 *310G probably null Het
Lnx1 A G 5: 74,620,122 V246A probably benign Het
Ly75 C T 2: 60,316,098 E1279K probably benign Het
Lztr1 T A 16: 17,519,441 C233S probably benign Het
Mfsd6l T G 11: 68,556,710 I129S probably benign Het
Mrgprx2 T A 7: 48,499,190 probably benign Het
Olfr1115 T A 2: 87,252,202 Y88* probably null Het
Olfr1121 T A 2: 87,372,141 M203K possibly damaging Het
Olfr447 G T 6: 42,911,891 V123L possibly damaging Het
Olfr948 A C 9: 39,318,723 V297G probably damaging Het
Pde6a A G 18: 61,263,976 H631R probably damaging Het
Pfkl C T 10: 77,988,960 G665D probably damaging Het
Pik3ap1 T A 19: 41,281,991 E753V probably damaging Het
Pik3cd G T 4: 149,655,598 R502S probably benign Het
Piwil2 T A 14: 70,390,535 I762L probably benign Het
Pkd1 T A 17: 24,565,662 L394* probably null Het
Plekhb2 A G 1: 34,876,965 D195G probably benign Het
Plppr5 T C 3: 117,662,454 M208T probably damaging Het
Polr2i G A 7: 30,233,088 V115I unknown Het
Prkacb T C 3: 146,750,484 S187G probably null Het
Prkag3 G T 1: 74,741,194 H437Q probably benign Het
Prlr T A 15: 10,319,266 Y94N probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psd4 A G 2: 24,397,480 R475G Het
Rad51b G A 12: 79,300,643 C27Y probably damaging Het
Scfd2 A G 5: 74,530,964 L219P probably damaging Het
Scn5a G A 9: 119,552,076 probably benign Het
Sec24d T C 3: 123,327,638 V391A probably benign Het
Selenbp2 T A 3: 94,700,025 L251Q probably damaging Het
Sh3rf1 T C 8: 61,374,168 V652A probably benign Het
Slc11a2 A G 15: 100,403,305 V289A probably benign Het
Sox8 T A 17: 25,570,161 Y121F probably damaging Het
Taar7a A T 10: 23,992,835 I216N probably damaging Het
Tanc1 T A 2: 59,791,880 S448T probably benign Het
Tas2r119 G A 15: 32,178,080 G264D probably damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trim17 A G 11: 58,965,231 E38G probably damaging Het
Ttn T A 2: 76,741,620 M26310L probably damaging Het
Unc13c T G 9: 73,546,040 I1823L probably benign Het
Vav2 C A 2: 27,270,139 E728* probably null Het
Virma A G 4: 11,540,494 D1465G probably benign Het
Vmn2r72 T G 7: 85,749,180 M531L probably benign Het
Vwa3b G A 1: 37,164,516 V59I possibly damaging Het
Xrcc1 G A 7: 24,572,217 E542K probably benign Het
Zdhhc6 T G 19: 55,298,886 T381P probably benign Het
Zdhhc8 T C 16: 18,223,277 S740G probably damaging Het
Zfp106 T C 2: 120,533,538 K819R probably damaging Het
Other mutations in Insrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Insrr APN 3 87813674 critical splice donor site probably null
IGL00801:Insrr APN 3 87813808 missense probably damaging 1.00
IGL01628:Insrr APN 3 87800792 nonsense probably null
IGL01755:Insrr APN 3 87814186 missense probably damaging 1.00
IGL02100:Insrr APN 3 87811620 missense probably damaging 1.00
IGL02261:Insrr APN 3 87800722 missense probably damaging 1.00
IGL02366:Insrr APN 3 87809909 missense possibly damaging 0.91
IGL02387:Insrr APN 3 87813127 missense probably damaging 1.00
IGL02478:Insrr APN 3 87809412 missense probably benign 0.14
IGL02550:Insrr APN 3 87804498 missense probably damaging 1.00
IGL02555:Insrr APN 3 87813817 missense probably damaging 0.99
IGL02673:Insrr APN 3 87813061 missense possibly damaging 0.95
IGL02724:Insrr APN 3 87809572 missense probably benign 0.31
IGL02798:Insrr APN 3 87810517 missense probably damaging 1.00
IGL02969:Insrr APN 3 87814191 nonsense probably null
IGL03073:Insrr APN 3 87809938 splice site probably benign
IGL03178:Insrr APN 3 87802541 splice site probably null
IGL03389:Insrr APN 3 87808731 missense probably damaging 1.00
IGL03399:Insrr APN 3 87809331 missense probably null 0.99
IGL02799:Insrr UTSW 3 87813581 missense probably damaging 1.00
R0011:Insrr UTSW 3 87809616 missense possibly damaging 0.86
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0053:Insrr UTSW 3 87800452 missense probably damaging 1.00
R0357:Insrr UTSW 3 87808646 splice site probably null
R0501:Insrr UTSW 3 87810684 missense probably benign 0.12
R0504:Insrr UTSW 3 87813156 missense possibly damaging 0.69
R0522:Insrr UTSW 3 87800872 missense probably damaging 1.00
R0555:Insrr UTSW 3 87814437 splice site probably benign
R0558:Insrr UTSW 3 87810981 missense possibly damaging 0.77
R0599:Insrr UTSW 3 87813133 missense probably damaging 0.97
R1312:Insrr UTSW 3 87800490 missense probably damaging 1.00
R1694:Insrr UTSW 3 87804062 missense probably benign
R1785:Insrr UTSW 3 87810572 splice site probably null
R1786:Insrr UTSW 3 87810572 splice site probably null
R1892:Insrr UTSW 3 87813877 missense probably damaging 1.00
R1950:Insrr UTSW 3 87814513 missense probably damaging 1.00
R2080:Insrr UTSW 3 87814291 missense possibly damaging 0.79
R2094:Insrr UTSW 3 87803181 missense probably damaging 1.00
R2130:Insrr UTSW 3 87810572 splice site probably null
R2131:Insrr UTSW 3 87810572 splice site probably null
R2133:Insrr UTSW 3 87810572 splice site probably null
R2220:Insrr UTSW 3 87809418 missense probably damaging 1.00
R2259:Insrr UTSW 3 87800452 missense probably damaging 1.00
R2404:Insrr UTSW 3 87802667 missense possibly damaging 0.71
R4027:Insrr UTSW 3 87809599 missense probably benign
R4042:Insrr UTSW 3 87813827 missense probably damaging 1.00
R4510:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4511:Insrr UTSW 3 87808671 missense possibly damaging 0.67
R4571:Insrr UTSW 3 87800887 missense probably benign
R4870:Insrr UTSW 3 87811604 missense probably damaging 1.00
R5057:Insrr UTSW 3 87815265 missense probably benign 0.00
R5393:Insrr UTSW 3 87810700 splice site probably null
R5685:Insrr UTSW 3 87800496 splice site probably null
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6039:Insrr UTSW 3 87809301 missense possibly damaging 0.56
R6047:Insrr UTSW 3 87804176 missense probably damaging 1.00
R6276:Insrr UTSW 3 87800519 nonsense probably null
R6298:Insrr UTSW 3 87812965 missense probably damaging 1.00
R6726:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6727:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6728:Insrr UTSW 3 87813566 missense probably damaging 1.00
R6796:Insrr UTSW 3 87813566 missense probably damaging 1.00
R7041:Insrr UTSW 3 87815244 missense probably damaging 1.00
R7169:Insrr UTSW 3 87808594 missense probably benign 0.15
R7270:Insrr UTSW 3 87803133 missense probably damaging 1.00
R7340:Insrr UTSW 3 87814316 critical splice donor site probably null
R7398:Insrr UTSW 3 87808732 missense probably damaging 1.00
R7473:Insrr UTSW 3 87804531 splice site probably null
R7815:Insrr UTSW 3 87808695 missense probably damaging 0.98
R8159:Insrr UTSW 3 87800428 missense probably damaging 1.00
R8289:Insrr UTSW 3 87814194 missense probably damaging 1.00
R8309:Insrr UTSW 3 87810442 missense probably benign 0.00
R8312:Insrr UTSW 3 87800484 missense possibly damaging 0.93
R8445:Insrr UTSW 3 87813584 missense probably damaging 1.00
R8917:Insrr UTSW 3 87810969 missense probably benign 0.00
R8960:Insrr UTSW 3 87813079 missense probably damaging 1.00
R8989:Insrr UTSW 3 87815357 missense probably damaging 0.96
R9202:Insrr UTSW 3 87813120 missense probably damaging 1.00
R9251:Insrr UTSW 3 87810084 missense probably benign 0.08
R9327:Insrr UTSW 3 87814297 missense probably damaging 1.00
RF022:Insrr UTSW 3 87804485 missense possibly damaging 0.51
Z1177:Insrr UTSW 3 87800827 missense possibly damaging 0.91
Z1192:Insrr UTSW 3 87802579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTCAGGGGATTTTAGGTC -3'
(R):5'- ATGTCACTGAGTGCAGGCTG -3'

Sequencing Primer
(F):5'- TTTAGGTCAGGATTAGGATGACAC -3'
(R):5'- AGGCCGGGGTTGTTCTACAG -3'
Posted On 2021-10-11