Mutagenetix > Incidental Mutations

Incidental Mutation 'R9015:Sec24d'

685898

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9015 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123327638 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 391 (V391A)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably benign
Transcript: ENSMUST00000047923
AA Change: V391A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: V391A

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	A	G	4: 86,232,610	D335G	probably damaging	Het
AI413582	T	C	17: 27,564,249	D48G	probably benign	Het
Alas1	A	T	9: 106,236,471	I525N	probably benign	Het
Aox2	G	A	1: 58,343,692	V1044M	probably damaging	Het
Apcdd1	A	T	18: 62,950,086	Y329F	possibly damaging	Het
Arhgap10	A	C	8: 77,259,058	C727G	probably benign	Het
Arid4a	G	A	12: 71,075,394	D528N	possibly damaging	Het
Atp8a1	A	G	5: 67,729,907	V611A		Het
BC004004	T	C	17: 29,298,663	F284L	probably damaging	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cep295	T	C	9: 15,332,968	I1397M	probably benign	Het
Cep63	A	G	9: 102,618,912	S99P	probably damaging	Het
Coq3	T	A	4: 21,899,107	S147T	probably benign	Het
Crym	A	T	7: 120,201,867	S20T	probably benign	Het
Ctr9	T	A	7: 111,043,901	N493K	probably benign	Het
Dchs2	A	G	3: 83,281,444	I1372V	possibly damaging	Het
Ddi2	G	A	4: 141,685,436	T55M	probably benign	Het
Dnah1	T	C	14: 31,264,359	M3724V	probably damaging	Het
Dst	A	G	1: 34,287,256	I4690V	probably benign	Het
Ect2l	T	C	10: 18,163,400	T429A	probably benign	Het
Eif3c	G	T	7: 126,556,366	H577N	probably damaging	Het
Erg	A	G	16: 95,361,267	S334P	possibly damaging	Het
Faf2	A	G	13: 54,648,326	S127G	probably benign	Het
Fbxl3	T	A	14: 103,092,354	T141S	possibly damaging	Het
Fbxw4	T	A	19: 45,636,435	M122L	probably benign	Het
Fgd4	T	C	16: 16,454,077	M476V	probably damaging	Het
Flvcr2	A	T	12: 85,783,005	I263F	probably benign	Het
Gadl1	A	T	9: 115,965,637	R293S	probably benign	Het
Gm11983	G	T	11: 6,837,033	F31L	unknown	Het
Gmnn	A	T	13: 24,756,655	N70K	probably benign	Het
Gpr3	A	G	4: 133,211,079	V94A	possibly damaging	Het
Greb1l	A	G	18: 10,541,675	S1141G	probably benign	Het
Helz2	A	T	2: 181,228,999	V2892E	probably damaging	Het
Hivep1	T	A	13: 42,158,373	M1363K	probably benign	Het
Hk1	T	A	10: 62,292,339	T336S	possibly damaging	Het
Hpgds	A	T	6: 65,138,245	I18N	possibly damaging	Het
Insrr	T	A	3: 87,813,603	L1056Q	probably damaging	Het
Ints10	A	G	8: 68,807,487	M288V	probably benign	Het
Itgb6	T	C	2: 60,654,688	D237G	probably damaging	Het
Kcnf1	A	G	12: 17,175,302	I306T	probably damaging	Het
Kdm3b	G	A	18: 34,830,159	G1556D	probably damaging	Het
Kif5b	A	G	18: 6,216,892	L477P	probably damaging	Het
Klf5	T	G	14: 99,303,483	*310G	probably null	Het
Lnx1	A	G	5: 74,620,122	V246A	probably benign	Het
Ly75	C	T	2: 60,316,098	E1279K	probably benign	Het
Lztr1	T	A	16: 17,519,441	C233S	probably benign	Het
Mfsd6l	T	G	11: 68,556,710	I129S	probably benign	Het
Mrgprx2	T	A	7: 48,499,190		probably benign	Het
Olfr1115	T	A	2: 87,252,202	Y88*	probably null	Het
Olfr1121	T	A	2: 87,372,141	M203K	possibly damaging	Het
Olfr447	G	T	6: 42,911,891	V123L	possibly damaging	Het
Olfr948	A	C	9: 39,318,723	V297G	probably damaging	Het
Pde6a	A	G	18: 61,263,976	H631R	probably damaging	Het
Pfkl	C	T	10: 77,988,960	G665D	probably damaging	Het
Pik3ap1	T	A	19: 41,281,991	E753V	probably damaging	Het
Pik3cd	G	T	4: 149,655,598	R502S	probably benign	Het
Piwil2	T	A	14: 70,390,535	I762L	probably benign	Het
Pkd1	T	A	17: 24,565,662	L394*	probably null	Het
Plekhb2	A	G	1: 34,876,965	D195G	probably benign	Het
Plppr5	T	C	3: 117,662,454	M208T	probably damaging	Het
Polr2i	G	A	7: 30,233,088	V115I	unknown	Het
Prkacb	T	C	3: 146,750,484	S187G	probably null	Het
Prkag3	G	T	1: 74,741,194	H437Q	probably benign	Het
Prlr	T	A	15: 10,319,266	Y94N	probably damaging	Het
Prmt6	T	C	3: 110,249,898	I358M	probably benign	Het
Psd4	A	G	2: 24,397,480	R475G		Het
Rad51b	G	A	12: 79,300,643	C27Y	probably damaging	Het
Scfd2	A	G	5: 74,530,964	L219P	probably damaging	Het
Scn5a	G	A	9: 119,552,076		probably benign	Het
Selenbp2	T	A	3: 94,700,025	L251Q	probably damaging	Het
Sh3rf1	T	C	8: 61,374,168	V652A	probably benign	Het
Slc11a2	A	G	15: 100,403,305	V289A	probably benign	Het
Sox8	T	A	17: 25,570,161	Y121F	probably damaging	Het
Taar7a	A	T	10: 23,992,835	I216N	probably damaging	Het
Tanc1	T	A	2: 59,791,880	S448T	probably benign	Het
Tas2r119	G	A	15: 32,178,080	G264D	probably damaging	Het
Trav7-6	A	G	14: 53,717,147	K65E	probably benign	Het
Trim17	A	G	11: 58,965,231	E38G	probably damaging	Het
Ttn	T	A	2: 76,741,620	M26310L	probably damaging	Het
Unc13c	T	G	9: 73,546,040	I1823L	probably benign	Het
Vav2	C	A	2: 27,270,139	E728*	probably null	Het
Virma	A	G	4: 11,540,494	D1465G	probably benign	Het
Vmn2r72	T	G	7: 85,749,180	M531L	probably benign	Het
Vwa3b	G	A	1: 37,164,516	V59I	possibly damaging	Het
Xrcc1	G	A	7: 24,572,217	E542K	probably benign	Het
Zdhhc6	T	G	19: 55,298,886	T381P	probably benign	Het
Zdhhc8	T	C	16: 18,223,277	S740G	probably damaging	Het
Zfp106	T	C	2: 120,533,538	K819R	probably damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5078:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAATCAGTCCCACTGGAGGATG -3'
(R):5'- AGAGCAACCCAGGACTCATG -3'

Sequencing Primer
(F):5'- TCCCACTGGAGGATGACACC -3'
(R):5'- CTCATGAAAGAGGCATGTCTAGAAC -3'

Posted On

2021-10-11