Incidental Mutation 'R9015:Sec24d'
ID 685898
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123327638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
AA Change: V391A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,232,610 D335G probably damaging Het
AI413582 T C 17: 27,564,249 D48G probably benign Het
Alas1 A T 9: 106,236,471 I525N probably benign Het
Aox2 G A 1: 58,343,692 V1044M probably damaging Het
Apcdd1 A T 18: 62,950,086 Y329F possibly damaging Het
Arhgap10 A C 8: 77,259,058 C727G probably benign Het
Arid4a G A 12: 71,075,394 D528N possibly damaging Het
Atp8a1 A G 5: 67,729,907 V611A Het
BC004004 T C 17: 29,298,663 F284L probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep295 T C 9: 15,332,968 I1397M probably benign Het
Cep63 A G 9: 102,618,912 S99P probably damaging Het
Coq3 T A 4: 21,899,107 S147T probably benign Het
Crym A T 7: 120,201,867 S20T probably benign Het
Ctr9 T A 7: 111,043,901 N493K probably benign Het
Dchs2 A G 3: 83,281,444 I1372V possibly damaging Het
Ddi2 G A 4: 141,685,436 T55M probably benign Het
Dnah1 T C 14: 31,264,359 M3724V probably damaging Het
Dst A G 1: 34,287,256 I4690V probably benign Het
Ect2l T C 10: 18,163,400 T429A probably benign Het
Eif3c G T 7: 126,556,366 H577N probably damaging Het
Erg A G 16: 95,361,267 S334P possibly damaging Het
Faf2 A G 13: 54,648,326 S127G probably benign Het
Fbxl3 T A 14: 103,092,354 T141S possibly damaging Het
Fbxw4 T A 19: 45,636,435 M122L probably benign Het
Fgd4 T C 16: 16,454,077 M476V probably damaging Het
Flvcr2 A T 12: 85,783,005 I263F probably benign Het
Gadl1 A T 9: 115,965,637 R293S probably benign Het
Gm11983 G T 11: 6,837,033 F31L unknown Het
Gmnn A T 13: 24,756,655 N70K probably benign Het
Gpr3 A G 4: 133,211,079 V94A possibly damaging Het
Greb1l A G 18: 10,541,675 S1141G probably benign Het
Helz2 A T 2: 181,228,999 V2892E probably damaging Het
Hivep1 T A 13: 42,158,373 M1363K probably benign Het
Hk1 T A 10: 62,292,339 T336S possibly damaging Het
Hpgds A T 6: 65,138,245 I18N possibly damaging Het
Insrr T A 3: 87,813,603 L1056Q probably damaging Het
Ints10 A G 8: 68,807,487 M288V probably benign Het
Itgb6 T C 2: 60,654,688 D237G probably damaging Het
Kcnf1 A G 12: 17,175,302 I306T probably damaging Het
Kdm3b G A 18: 34,830,159 G1556D probably damaging Het
Kif5b A G 18: 6,216,892 L477P probably damaging Het
Klf5 T G 14: 99,303,483 *310G probably null Het
Lnx1 A G 5: 74,620,122 V246A probably benign Het
Ly75 C T 2: 60,316,098 E1279K probably benign Het
Lztr1 T A 16: 17,519,441 C233S probably benign Het
Mfsd6l T G 11: 68,556,710 I129S probably benign Het
Mrgprx2 T A 7: 48,499,190 probably benign Het
Olfr1115 T A 2: 87,252,202 Y88* probably null Het
Olfr1121 T A 2: 87,372,141 M203K possibly damaging Het
Olfr447 G T 6: 42,911,891 V123L possibly damaging Het
Olfr948 A C 9: 39,318,723 V297G probably damaging Het
Pde6a A G 18: 61,263,976 H631R probably damaging Het
Pfkl C T 10: 77,988,960 G665D probably damaging Het
Pik3ap1 T A 19: 41,281,991 E753V probably damaging Het
Pik3cd G T 4: 149,655,598 R502S probably benign Het
Piwil2 T A 14: 70,390,535 I762L probably benign Het
Pkd1 T A 17: 24,565,662 L394* probably null Het
Plekhb2 A G 1: 34,876,965 D195G probably benign Het
Plppr5 T C 3: 117,662,454 M208T probably damaging Het
Polr2i G A 7: 30,233,088 V115I unknown Het
Prkacb T C 3: 146,750,484 S187G probably null Het
Prkag3 G T 1: 74,741,194 H437Q probably benign Het
Prlr T A 15: 10,319,266 Y94N probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psd4 A G 2: 24,397,480 R475G Het
Rad51b G A 12: 79,300,643 C27Y probably damaging Het
Scfd2 A G 5: 74,530,964 L219P probably damaging Het
Scn5a G A 9: 119,552,076 probably benign Het
Selenbp2 T A 3: 94,700,025 L251Q probably damaging Het
Sh3rf1 T C 8: 61,374,168 V652A probably benign Het
Slc11a2 A G 15: 100,403,305 V289A probably benign Het
Sox8 T A 17: 25,570,161 Y121F probably damaging Het
Taar7a A T 10: 23,992,835 I216N probably damaging Het
Tanc1 T A 2: 59,791,880 S448T probably benign Het
Tas2r119 G A 15: 32,178,080 G264D probably damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trim17 A G 11: 58,965,231 E38G probably damaging Het
Ttn T A 2: 76,741,620 M26310L probably damaging Het
Unc13c T G 9: 73,546,040 I1823L probably benign Het
Vav2 C A 2: 27,270,139 E728* probably null Het
Virma A G 4: 11,540,494 D1465G probably benign Het
Vmn2r72 T G 7: 85,749,180 M531L probably benign Het
Vwa3b G A 1: 37,164,516 V59I possibly damaging Het
Xrcc1 G A 7: 24,572,217 E542K probably benign Het
Zdhhc6 T G 19: 55,298,886 T381P probably benign Het
Zdhhc8 T C 16: 18,223,277 S740G probably damaging Het
Zfp106 T C 2: 120,533,538 K819R probably damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAATCAGTCCCACTGGAGGATG -3'
(R):5'- AGAGCAACCCAGGACTCATG -3'

Sequencing Primer
(F):5'- TCCCACTGGAGGATGACACC -3'
(R):5'- CTCATGAAAGAGGCATGTCTAGAAC -3'
Posted On 2021-10-11