Incidental Mutation 'R9015:Atp8a1'
ID685906
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R9015 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67729907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 611 (V611A)
Ref Sequence ENSEMBL: ENSMUSP00000042215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000135930] [ENSMUST00000200955]
Predicted Effect
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685
AA Change: V611A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
AA Change: V611A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685
AA Change: V611A

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
AA Change: V596A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685
AA Change: V596A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,232,610 D335G probably damaging Het
AI413582 T C 17: 27,564,249 D48G probably benign Het
Alas1 A T 9: 106,236,471 I525N probably benign Het
Aox2 G A 1: 58,343,692 V1044M probably damaging Het
Apcdd1 A T 18: 62,950,086 Y329F possibly damaging Het
Arhgap10 A C 8: 77,259,058 C727G probably benign Het
Arid4a G A 12: 71,075,394 D528N possibly damaging Het
BC004004 T C 17: 29,298,663 F284L probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep295 T C 9: 15,332,968 I1397M probably benign Het
Cep63 A G 9: 102,618,912 S99P probably damaging Het
Coq3 T A 4: 21,899,107 S147T probably benign Het
Crym A T 7: 120,201,867 S20T probably benign Het
Ctr9 T A 7: 111,043,901 N493K probably benign Het
Dchs2 A G 3: 83,281,444 I1372V possibly damaging Het
Ddi2 G A 4: 141,685,436 T55M probably benign Het
Dnah1 T C 14: 31,264,359 M3724V probably damaging Het
Dst A G 1: 34,287,256 I4690V probably benign Het
Ect2l T C 10: 18,163,400 T429A probably benign Het
Eif3c G T 7: 126,556,366 H577N probably damaging Het
Erg A G 16: 95,361,267 S334P possibly damaging Het
Faf2 A G 13: 54,648,326 S127G probably benign Het
Fbxl3 T A 14: 103,092,354 T141S possibly damaging Het
Fbxw4 T A 19: 45,636,435 M122L probably benign Het
Fgd4 T C 16: 16,454,077 M476V probably damaging Het
Flvcr2 A T 12: 85,783,005 I263F probably benign Het
Gadl1 A T 9: 115,965,637 R293S probably benign Het
Gm11983 G T 11: 6,837,033 F31L unknown Het
Gmnn A T 13: 24,756,655 N70K probably benign Het
Gpr3 A G 4: 133,211,079 V94A possibly damaging Het
Greb1l A G 18: 10,541,675 S1141G probably benign Het
Helz2 A T 2: 181,228,999 V2892E probably damaging Het
Hivep1 T A 13: 42,158,373 M1363K probably benign Het
Hk1 T A 10: 62,292,339 T336S possibly damaging Het
Hpgds A T 6: 65,138,245 I18N possibly damaging Het
Insrr T A 3: 87,813,603 L1056Q probably damaging Het
Ints10 A G 8: 68,807,487 M288V probably benign Het
Itgb6 T C 2: 60,654,688 D237G probably damaging Het
Kcnf1 A G 12: 17,175,302 I306T probably damaging Het
Kdm3b G A 18: 34,830,159 G1556D probably damaging Het
Kif5b A G 18: 6,216,892 L477P probably damaging Het
Klf5 T G 14: 99,303,483 *310G probably null Het
Lnx1 A G 5: 74,620,122 V246A probably benign Het
Ly75 C T 2: 60,316,098 E1279K probably benign Het
Lztr1 T A 16: 17,519,441 C233S probably benign Het
Mfsd6l T G 11: 68,556,710 I129S probably benign Het
Mrgprx2 T A 7: 48,499,190 probably benign Het
Olfr1115 T A 2: 87,252,202 Y88* probably null Het
Olfr1121 T A 2: 87,372,141 M203K possibly damaging Het
Olfr447 G T 6: 42,911,891 V123L possibly damaging Het
Olfr948 A C 9: 39,318,723 V297G probably damaging Het
Pde6a A G 18: 61,263,976 H631R probably damaging Het
Pfkl C T 10: 77,988,960 G665D probably damaging Het
Pik3ap1 T A 19: 41,281,991 E753V probably damaging Het
Pik3cd G T 4: 149,655,598 R502S probably benign Het
Piwil2 T A 14: 70,390,535 I762L probably benign Het
Pkd1 T A 17: 24,565,662 L394* probably null Het
Plekhb2 A G 1: 34,876,965 D195G probably benign Het
Plppr5 T C 3: 117,662,454 M208T probably damaging Het
Polr2i G A 7: 30,233,088 V115I unknown Het
Prkacb T C 3: 146,750,484 S187G probably null Het
Prkag3 G T 1: 74,741,194 H437Q probably benign Het
Prlr T A 15: 10,319,266 Y94N probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psd4 A G 2: 24,397,480 R475G Het
Rad51b G A 12: 79,300,643 C27Y probably damaging Het
Scfd2 A G 5: 74,530,964 L219P probably damaging Het
Scn5a G A 9: 119,552,076 probably benign Het
Sec24d T C 3: 123,327,638 V391A probably benign Het
Selenbp2 T A 3: 94,700,025 L251Q probably damaging Het
Sh3rf1 T C 8: 61,374,168 V652A probably benign Het
Slc11a2 A G 15: 100,403,305 V289A probably benign Het
Sox8 T A 17: 25,570,161 Y121F probably damaging Het
Taar7a A T 10: 23,992,835 I216N probably damaging Het
Tanc1 T A 2: 59,791,880 S448T probably benign Het
Tas2r119 G A 15: 32,178,080 G264D probably damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trim17 A G 11: 58,965,231 E38G probably damaging Het
Ttn T A 2: 76,741,620 M26310L probably damaging Het
Unc13c T G 9: 73,546,040 I1823L probably benign Het
Vav2 C A 2: 27,270,139 E728* probably null Het
Virma A G 4: 11,540,494 D1465G probably benign Het
Vmn2r72 T G 7: 85,749,180 M531L probably benign Het
Vwa3b G A 1: 37,164,516 V59I possibly damaging Het
Xrcc1 G A 7: 24,572,217 E542K probably benign Het
Zdhhc6 T G 19: 55,298,886 T381P probably benign Het
Zdhhc8 T C 16: 18,223,277 S740G probably damaging Het
Zfp106 T C 2: 120,533,538 K819R probably damaging Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7548:Atp8a1 UTSW 5 67815728 nonsense probably null
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
R9052:Atp8a1 UTSW 5 67778958 critical splice donor site probably null
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGTCCCCAAGCAAAGAATGG -3'
(R):5'- TCGAGGGTCTGGGAATCATGAG -3'

Sequencing Primer
(F):5'- TCCCCAAGCAAAGAATGGACATTTG -3'
(R):5'- CTGGGAGAGCATTCTAGACATTG -3'
Posted On2021-10-11