Incidental Mutation 'R9015:Apcdd1'
ID 685963
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R9015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 62922327-62953195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62950086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 329 (Y329F)
Ref Sequence ENSEMBL: ENSMUSP00000094302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect possibly damaging
Transcript: ENSMUST00000096554
AA Change: Y329F

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: Y329F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163716
AA Change: Y329F

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: Y329F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,232,610 D335G probably damaging Het
AI413582 T C 17: 27,564,249 D48G probably benign Het
Alas1 A T 9: 106,236,471 I525N probably benign Het
Aox2 G A 1: 58,343,692 V1044M probably damaging Het
Arhgap10 A C 8: 77,259,058 C727G probably benign Het
Arid4a G A 12: 71,075,394 D528N possibly damaging Het
Atp8a1 A G 5: 67,729,907 V611A Het
BC004004 T C 17: 29,298,663 F284L probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Cep295 T C 9: 15,332,968 I1397M probably benign Het
Cep63 A G 9: 102,618,912 S99P probably damaging Het
Coq3 T A 4: 21,899,107 S147T probably benign Het
Crym A T 7: 120,201,867 S20T probably benign Het
Ctr9 T A 7: 111,043,901 N493K probably benign Het
Dchs2 A G 3: 83,281,444 I1372V possibly damaging Het
Ddi2 G A 4: 141,685,436 T55M probably benign Het
Dnah1 T C 14: 31,264,359 M3724V probably damaging Het
Dst A G 1: 34,287,256 I4690V probably benign Het
Ect2l T C 10: 18,163,400 T429A probably benign Het
Eif3c G T 7: 126,556,366 H577N probably damaging Het
Erg A G 16: 95,361,267 S334P possibly damaging Het
Faf2 A G 13: 54,648,326 S127G probably benign Het
Fbxl3 T A 14: 103,092,354 T141S possibly damaging Het
Fbxw4 T A 19: 45,636,435 M122L probably benign Het
Fgd4 T C 16: 16,454,077 M476V probably damaging Het
Flvcr2 A T 12: 85,783,005 I263F probably benign Het
Gadl1 A T 9: 115,965,637 R293S probably benign Het
Gm11983 G T 11: 6,837,033 F31L unknown Het
Gmnn A T 13: 24,756,655 N70K probably benign Het
Gpr3 A G 4: 133,211,079 V94A possibly damaging Het
Greb1l A G 18: 10,541,675 S1141G probably benign Het
Helz2 A T 2: 181,228,999 V2892E probably damaging Het
Hivep1 T A 13: 42,158,373 M1363K probably benign Het
Hk1 T A 10: 62,292,339 T336S possibly damaging Het
Hpgds A T 6: 65,138,245 I18N possibly damaging Het
Insrr T A 3: 87,813,603 L1056Q probably damaging Het
Ints10 A G 8: 68,807,487 M288V probably benign Het
Itgb6 T C 2: 60,654,688 D237G probably damaging Het
Kcnf1 A G 12: 17,175,302 I306T probably damaging Het
Kdm3b G A 18: 34,830,159 G1556D probably damaging Het
Kif5b A G 18: 6,216,892 L477P probably damaging Het
Klf5 T G 14: 99,303,483 *310G probably null Het
Lnx1 A G 5: 74,620,122 V246A probably benign Het
Ly75 C T 2: 60,316,098 E1279K probably benign Het
Lztr1 T A 16: 17,519,441 C233S probably benign Het
Mfsd6l T G 11: 68,556,710 I129S probably benign Het
Mrgprx2 T A 7: 48,499,190 probably benign Het
Olfr1115 T A 2: 87,252,202 Y88* probably null Het
Olfr1121 T A 2: 87,372,141 M203K possibly damaging Het
Olfr447 G T 6: 42,911,891 V123L possibly damaging Het
Olfr948 A C 9: 39,318,723 V297G probably damaging Het
Pde6a A G 18: 61,263,976 H631R probably damaging Het
Pfkl C T 10: 77,988,960 G665D probably damaging Het
Pik3ap1 T A 19: 41,281,991 E753V probably damaging Het
Pik3cd G T 4: 149,655,598 R502S probably benign Het
Piwil2 T A 14: 70,390,535 I762L probably benign Het
Pkd1 T A 17: 24,565,662 L394* probably null Het
Plekhb2 A G 1: 34,876,965 D195G probably benign Het
Plppr5 T C 3: 117,662,454 M208T probably damaging Het
Polr2i G A 7: 30,233,088 V115I unknown Het
Prkacb T C 3: 146,750,484 S187G probably null Het
Prkag3 G T 1: 74,741,194 H437Q probably benign Het
Prlr T A 15: 10,319,266 Y94N probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psd4 A G 2: 24,397,480 R475G Het
Rad51b G A 12: 79,300,643 C27Y probably damaging Het
Scfd2 A G 5: 74,530,964 L219P probably damaging Het
Scn5a G A 9: 119,552,076 probably benign Het
Sec24d T C 3: 123,327,638 V391A probably benign Het
Selenbp2 T A 3: 94,700,025 L251Q probably damaging Het
Sh3rf1 T C 8: 61,374,168 V652A probably benign Het
Slc11a2 A G 15: 100,403,305 V289A probably benign Het
Sox8 T A 17: 25,570,161 Y121F probably damaging Het
Taar7a A T 10: 23,992,835 I216N probably damaging Het
Tanc1 T A 2: 59,791,880 S448T probably benign Het
Tas2r119 G A 15: 32,178,080 G264D probably damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trim17 A G 11: 58,965,231 E38G probably damaging Het
Ttn T A 2: 76,741,620 M26310L probably damaging Het
Unc13c T G 9: 73,546,040 I1823L probably benign Het
Vav2 C A 2: 27,270,139 E728* probably null Het
Virma A G 4: 11,540,494 D1465G probably benign Het
Vmn2r72 T G 7: 85,749,180 M531L probably benign Het
Vwa3b G A 1: 37,164,516 V59I possibly damaging Het
Xrcc1 G A 7: 24,572,217 E542K probably benign Het
Zdhhc6 T G 19: 55,298,886 T381P probably benign Het
Zdhhc8 T C 16: 18,223,277 S740G probably damaging Het
Zfp106 T C 2: 120,533,538 K819R probably damaging Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 62934036 missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 62950056 missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 62933903 missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 62933915 missense possibly damaging 0.66
R9040:Apcdd1 UTSW 18 62937343 missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 62922660 start gained probably benign
R9295:Apcdd1 UTSW 18 62922660 start gained probably benign
R9297:Apcdd1 UTSW 18 62922660 start gained probably benign
R9317:Apcdd1 UTSW 18 62922660 start gained probably benign
R9319:Apcdd1 UTSW 18 62922660 start gained probably benign
R9393:Apcdd1 UTSW 18 62922660 start gained probably benign
R9394:Apcdd1 UTSW 18 62922660 start gained probably benign
R9396:Apcdd1 UTSW 18 62922660 start gained probably benign
R9397:Apcdd1 UTSW 18 62922660 start gained probably benign
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCGGTCAGATGAACACCAC -3'
(R):5'- AGACATGGCTCTCACTTCATCC -3'

Sequencing Primer
(F):5'- GGTCAGATGAACACCACCCTCC -3'
(R):5'- GCAGCAAAGATACCCTTTCTCTTAGG -3'
Posted On 2021-10-11