Incidental Mutation 'R9016:Fam171a1'
ID 685974
Institutional Source Beutler Lab
Gene Symbol Fam171a1
Ensembl Gene ENSMUSG00000050530
Gene Name family with sequence similarity 171, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9016 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 3114224-3227806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3226397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 856 (A856T)
Ref Sequence ENSEMBL: ENSMUSP00000110751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062934] [ENSMUST00000072955] [ENSMUST00000091505] [ENSMUST00000115099]
AlphaFold A2ATK9
Predicted Effect probably benign
Transcript: ENSMUST00000062934
AA Change: A851T

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053619
Gene: ENSMUSG00000050530
AA Change: A851T

DomainStartEndE-ValueType
Pfam:UPF0560 29 885 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072955
AA Change: A731T

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072724
Gene: ENSMUSG00000050530
AA Change: A731T

DomainStartEndE-ValueType
Pfam:UPF0560 1 765 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091505
SMART Domains Protein: ENSMUSP00000089086
Gene: ENSMUSG00000050530

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 294 3.1e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115099
AA Change: A856T

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110751
Gene: ENSMUSG00000050530
AA Change: A856T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:UPF0560 34 890 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 C A 18: 74,799,083 S264R probably damaging Het
Agap1 T C 1: 89,766,466 probably null Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Apob C T 12: 7,985,408 silent Het
Atg2a G C 19: 6,250,081 A640P probably damaging Het
AW209491 G A 13: 14,637,608 V349M probably damaging Het
Bmpr2 C T 1: 59,815,301 T103I probably damaging Het
Btaf1 A C 19: 36,994,305 E1231D probably benign Het
Btbd7 T C 12: 102,785,158 R1116G probably damaging Het
Catsperg1 A T 7: 29,191,737 M627K probably benign Het
Ccdc114 T G 7: 45,936,564 C128W probably damaging Het
Cdk7 G A 13: 100,717,618 T121I probably benign Het
Csmd3 T A 15: 47,659,042 T1833S Het
Dapk3 A T 10: 81,192,432 R279W probably damaging Het
Dnah9 T C 11: 66,108,030 E1064G probably damaging Het
Dner T C 1: 84,695,505 E75G probably benign Het
Dnmt1 T C 9: 20,936,559 E229G possibly damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fen1 A T 19: 10,200,942 V46D probably damaging Het
Ffar3 T C 7: 30,855,029 R289G probably damaging Het
Fhod3 G A 18: 25,110,079 E1165K possibly damaging Het
Fras1 A T 5: 96,636,064 H809L probably damaging Het
Gbp7 A T 3: 142,544,109 E447V probably benign Het
Gja8 T C 3: 96,920,205 D47G probably damaging Het
Gm13089 T C 4: 143,697,329 I297V possibly damaging Het
Gm5795 A G 14: 3,191,110 K144E probably benign Het
Gm7298 A C 6: 121,781,841 Q1139H possibly damaging Het
Gpa33 A T 1: 166,165,161 Y281F probably damaging Het
H2-M10.5 G A 17: 36,773,334 E63K possibly damaging Het
Hgf T C 5: 16,618,958 W718R probably damaging Het
Ifna5 C G 4: 88,835,809 D95E probably benign Het
Ifnar2 T C 16: 91,404,185 L438P possibly damaging Het
Ints1 T C 5: 139,758,571 T1479A probably benign Het
Kif1a C T 1: 93,025,673 R1263H probably damaging Het
Ltbp2 T C 12: 84,809,693 T686A probably benign Het
Med12l A T 3: 59,255,873 E1307V probably damaging Het
Mtcl1 T A 17: 66,344,067 T1468S probably damaging Het
Myo9a C T 9: 59,868,144 Q1013* probably null Het
Nckap5 T C 1: 126,695,754 M1V probably null Het
Nos3 G T 5: 24,383,641 V1122F probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr658 A T 7: 104,644,621 C250* probably null Het
Oscar A G 7: 3,616,073 V2A probably benign Het
P2rx6 T A 16: 17,567,440 H132Q possibly damaging Het
Pakap T C 4: 57,637,857 C12R unknown Het
Pde6b T A 5: 108,388,726 M96K possibly damaging Het
Polq T A 16: 37,022,797 L231Q probably damaging Het
Prrc2a G A 17: 35,159,868 T399I unknown Het
Rapsn A G 2: 91,036,827 D158G probably damaging Het
Rcor1 T A 12: 111,081,499 probably benign Het
Sema4d G T 13: 51,713,758 P186T probably damaging Het
Skiv2l A C 17: 34,844,664 L601R probably damaging Het
Slc4a7 G A 14: 14,773,241 R737Q probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Sox15 T G 11: 69,655,703 Y111D probably damaging Het
Spen C T 4: 141,473,627 C2563Y probably damaging Het
St5 A C 7: 109,540,435 D645E possibly damaging Het
Taf8 A T 17: 47,496,602 D153E probably damaging Het
Tet3 G A 6: 83,368,271 A1728V probably damaging Het
Tmem232 A T 17: 65,430,783 D427E probably benign Het
Tmem53 T C 4: 117,268,254 I188T probably benign Het
Tnc T G 4: 64,017,094 D535A probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Tnik G A 3: 28,638,395 G867R probably damaging Het
Uba3 A T 6: 97,185,733 C367* probably null Het
Vmn1r235 G T 17: 21,261,707 S98I possibly damaging Het
Vmn2r15 T C 5: 109,294,243 E108G probably benign Het
Xrra1 T A 7: 99,876,255 I127N probably benign Het
Zc3h18 G A 8: 122,403,224 R447Q unknown Het
Zcwpw1 C A 5: 137,800,078 P179Q probably damaging Het
Zfp526 C T 7: 25,225,839 H508Y probably damaging Het
Zfp583 T C 7: 6,317,405 K203E probably benign Het
Zfp979 A G 4: 147,613,047 C402R possibly damaging Het
Zxdc A G 6: 90,382,272 T629A probably damaging Het
Other mutations in Fam171a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Fam171a1 APN 2 3178290 missense possibly damaging 0.90
IGL01138:Fam171a1 APN 2 3202620 missense possibly damaging 0.80
IGL01317:Fam171a1 APN 2 3202626 missense probably damaging 1.00
IGL02377:Fam171a1 APN 2 3223586 critical splice donor site probably null
IGL02475:Fam171a1 APN 2 3223490 missense possibly damaging 0.53
IGL02477:Fam171a1 APN 2 3202575 missense possibly damaging 0.83
ghosted UTSW 2 3225152 nonsense probably null
R0167:Fam171a1 UTSW 2 3186432 missense probably damaging 1.00
R0426:Fam171a1 UTSW 2 3225396 missense probably benign
R0468:Fam171a1 UTSW 2 3225396 missense probably benign
R0811:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R0812:Fam171a1 UTSW 2 3197427 missense probably damaging 1.00
R1099:Fam171a1 UTSW 2 3225317 missense probably benign 0.24
R1694:Fam171a1 UTSW 2 3225623 missense probably benign 0.00
R1817:Fam171a1 UTSW 2 3178373 missense probably benign 0.04
R1869:Fam171a1 UTSW 2 3226152 missense possibly damaging 0.53
R1887:Fam171a1 UTSW 2 3220343 missense probably damaging 1.00
R2173:Fam171a1 UTSW 2 3225619 nonsense probably null
R2355:Fam171a1 UTSW 2 3225533 nonsense probably null
R3690:Fam171a1 UTSW 2 3226356 missense probably benign
R3723:Fam171a1 UTSW 2 3220375 splice site probably benign
R3978:Fam171a1 UTSW 2 3225035 missense probably benign
R4087:Fam171a1 UTSW 2 3226296 missense probably damaging 0.97
R4647:Fam171a1 UTSW 2 3220291 missense probably damaging 0.98
R4744:Fam171a1 UTSW 2 3224909 missense probably damaging 1.00
R4777:Fam171a1 UTSW 2 3223513 missense probably benign 0.03
R4786:Fam171a1 UTSW 2 3225578 missense probably damaging 1.00
R4888:Fam171a1 UTSW 2 3223509 missense probably damaging 0.98
R4982:Fam171a1 UTSW 2 3178468 splice site probably null
R5137:Fam171a1 UTSW 2 3225389 missense probably benign 0.01
R5203:Fam171a1 UTSW 2 3223545 missense probably damaging 0.99
R5233:Fam171a1 UTSW 2 3178353 missense probably damaging 1.00
R5304:Fam171a1 UTSW 2 3225617 missense probably damaging 1.00
R5475:Fam171a1 UTSW 2 3225297 missense possibly damaging 0.91
R5682:Fam171a1 UTSW 2 3226089 missense probably damaging 1.00
R5865:Fam171a1 UTSW 2 3225337 missense probably benign 0.01
R6322:Fam171a1 UTSW 2 3226355 missense probably benign 0.24
R7082:Fam171a1 UTSW 2 3223475 missense probably benign 0.00
R7141:Fam171a1 UTSW 2 3225152 nonsense probably null
R7155:Fam171a1 UTSW 2 3225729 missense probably benign 0.10
R7243:Fam171a1 UTSW 2 3118616 missense probably benign 0.07
R7326:Fam171a1 UTSW 2 3226472 nonsense probably null
R7477:Fam171a1 UTSW 2 3225639 missense probably benign 0.03
R7574:Fam171a1 UTSW 2 3220354 missense probably damaging 1.00
R7745:Fam171a1 UTSW 2 3225446 missense possibly damaging 0.53
R7753:Fam171a1 UTSW 2 3178317 missense probably damaging 0.98
R7871:Fam171a1 UTSW 2 3225384 missense probably benign 0.12
R7958:Fam171a1 UTSW 2 3178261 missense probably damaging 1.00
R8677:Fam171a1 UTSW 2 3220315 missense probably damaging 0.98
R8793:Fam171a1 UTSW 2 3186498 missense probably damaging 1.00
R8850:Fam171a1 UTSW 2 3220307 missense probably damaging 1.00
R8865:Fam171a1 UTSW 2 3225903 missense probably damaging 1.00
R9090:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9251:Fam171a1 UTSW 2 3225488 missense probably benign 0.06
R9271:Fam171a1 UTSW 2 3223506 missense probably damaging 1.00
R9350:Fam171a1 UTSW 2 3225000 missense probably benign 0.12
X0019:Fam171a1 UTSW 2 3225593 missense probably benign 0.19
Z1177:Fam171a1 UTSW 2 3224934 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCTCCTGTACCTTGAGGAC -3'
(R):5'- TTCTCCACACGCAGGTATG -3'

Sequencing Primer
(F):5'- TCCTGTACCTTGAGGACATGGAC -3'
(R):5'- GCACTTCCATGAGAAAGGATATTTGG -3'
Posted On 2021-10-11