Incidental Mutation 'R9016:Dnah9'
ID 686014
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 068846-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R9016 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65998856 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1064 (E1064G)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: E1064G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: E1064G

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 C A 18: 74,932,154 (GRCm39) S264R probably damaging Het
Agap1 T C 1: 89,694,188 (GRCm39) probably null Het
Amer2 G C 14: 60,617,376 (GRCm39) D524H probably damaging Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Apob C T 12: 8,035,408 (GRCm39) silent Het
Atg2a G C 19: 6,300,111 (GRCm39) A640P probably damaging Het
AW209491 G A 13: 14,812,193 (GRCm39) V349M probably damaging Het
Bmpr2 C T 1: 59,854,460 (GRCm39) T103I probably damaging Het
Btaf1 A C 19: 36,971,705 (GRCm39) E1231D probably benign Het
Btbd7 T C 12: 102,751,417 (GRCm39) R1116G probably damaging Het
Catsperg1 A T 7: 28,891,162 (GRCm39) M627K probably benign Het
Cdk7 G A 13: 100,854,126 (GRCm39) T121I probably benign Het
Csmd3 T A 15: 47,522,438 (GRCm39) T1833S Het
Dapk3 A T 10: 81,028,266 (GRCm39) R279W probably damaging Het
Dennd2b A C 7: 109,139,642 (GRCm39) D645E possibly damaging Het
Dner T C 1: 84,673,226 (GRCm39) E75G probably benign Het
Dnmt1 T C 9: 20,847,855 (GRCm39) E229G possibly damaging Het
Fam171a1 G A 2: 3,227,434 (GRCm39) A856T probably benign Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fen1 A T 19: 10,178,306 (GRCm39) V46D probably damaging Het
Ffar3 T C 7: 30,554,454 (GRCm39) R289G probably damaging Het
Fhod3 G A 18: 25,243,136 (GRCm39) E1165K possibly damaging Het
Fras1 A T 5: 96,783,923 (GRCm39) H809L probably damaging Het
Gbp7 A T 3: 142,249,870 (GRCm39) E447V probably benign Het
Gja8 T C 3: 96,827,521 (GRCm39) D47G probably damaging Het
Gm5795 A G 14: 14,883,574 (GRCm39) K144E probably benign Het
Gm7298 A C 6: 121,758,800 (GRCm39) Q1139H possibly damaging Het
Gpa33 A T 1: 165,992,730 (GRCm39) Y281F probably damaging Het
H2-M10.5 G A 17: 37,084,226 (GRCm39) E63K possibly damaging Het
Hgf T C 5: 16,823,956 (GRCm39) W718R probably damaging Het
Ifna5 C G 4: 88,754,046 (GRCm39) D95E probably benign Het
Ifnar2 T C 16: 91,201,073 (GRCm39) L438P possibly damaging Het
Ints1 T C 5: 139,744,326 (GRCm39) T1479A probably benign Het
Kif1a C T 1: 92,953,395 (GRCm39) R1263H probably damaging Het
Ltbp2 T C 12: 84,856,467 (GRCm39) T686A probably benign Het
Med12l A T 3: 59,163,294 (GRCm39) E1307V probably damaging Het
Mtcl1 T A 17: 66,651,062 (GRCm39) T1468S probably damaging Het
Myo9a C T 9: 59,775,427 (GRCm39) Q1013* probably null Het
Nckap5 T C 1: 126,623,491 (GRCm39) M1V probably null Het
Nos3 G T 5: 24,588,639 (GRCm39) V1122F probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Odad1 T G 7: 45,585,988 (GRCm39) C128W probably damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or52n4 A T 7: 104,293,828 (GRCm39) C250* probably null Het
Oscar A G 7: 3,619,072 (GRCm39) V2A probably benign Het
P2rx6 T A 16: 17,385,304 (GRCm39) H132Q possibly damaging Het
Pakap T C 4: 57,637,857 (GRCm39) C12R unknown Het
Pde6b T A 5: 108,536,592 (GRCm39) M96K possibly damaging Het
Polq T A 16: 36,843,159 (GRCm39) L231Q probably damaging Het
Pramel23 T C 4: 143,423,899 (GRCm39) I297V possibly damaging Het
Prrc2a G A 17: 35,378,844 (GRCm39) T399I unknown Het
Rapsn A G 2: 90,867,172 (GRCm39) D158G probably damaging Het
Rcor1 T A 12: 111,047,933 (GRCm39) probably benign Het
Sema4d G T 13: 51,867,794 (GRCm39) P186T probably damaging Het
Skic2 A C 17: 35,063,640 (GRCm39) L601R probably damaging Het
Slc4a7 G A 14: 14,773,241 (GRCm38) R737Q probably damaging Het
Sorbs2 T G 8: 46,248,774 (GRCm39) V675G probably benign Het
Sox15 T G 11: 69,546,529 (GRCm39) Y111D probably damaging Het
Spen C T 4: 141,200,938 (GRCm39) C2563Y probably damaging Het
Taf8 A T 17: 47,807,527 (GRCm39) D153E probably damaging Het
Tet3 G A 6: 83,345,253 (GRCm39) A1728V probably damaging Het
Tmem232 A T 17: 65,737,778 (GRCm39) D427E probably benign Het
Tmem53 T C 4: 117,125,451 (GRCm39) I188T probably benign Het
Tnc T G 4: 63,935,331 (GRCm39) D535A probably benign Het
Tnfrsf11a G A 1: 105,754,854 (GRCm39) A309T possibly damaging Het
Tnik G A 3: 28,692,544 (GRCm39) G867R probably damaging Het
Uba3 A T 6: 97,162,694 (GRCm39) C367* probably null Het
Vmn1r235 G T 17: 21,481,969 (GRCm39) S98I possibly damaging Het
Vmn2r15 T C 5: 109,442,109 (GRCm39) E108G probably benign Het
Xrra1 T A 7: 99,525,462 (GRCm39) I127N probably benign Het
Zc3h18 G A 8: 123,129,963 (GRCm39) R447Q unknown Het
Zcwpw1 C A 5: 137,798,340 (GRCm39) P179Q probably damaging Het
Zfp526 C T 7: 24,925,264 (GRCm39) H508Y probably damaging Het
Zfp583 T C 7: 6,320,404 (GRCm39) K203E probably benign Het
Zfp979 A G 4: 147,697,504 (GRCm39) C402R possibly damaging Het
Zxdc A G 6: 90,359,254 (GRCm39) T629A probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGGGATGCTAGTAGGTAG -3'
(R):5'- ATATGATGACCCTCTGCTGTG -3'

Sequencing Primer
(F):5'- TAGCCAGGACAATGATGTTACCTG -3'
(R):5'- GCTGTGGCTATAGAAATACCCTCAG -3'
Posted On 2021-10-11