Incidental Mutation 'R9016:Btbd7'
ID 686017
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R9016 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102785158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1116 (R1116G)
Ref Sequence ENSEMBL: ENSMUSP00000046951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: R1116G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: R1116G

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: R1116G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 C A 18: 74,799,083 S264R probably damaging Het
Agap1 T C 1: 89,766,466 probably null Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Atg2a G C 19: 6,250,081 A640P probably damaging Het
AW209491 G A 13: 14,637,608 V349M probably damaging Het
Bmpr2 C T 1: 59,815,301 T103I probably damaging Het
Btaf1 A C 19: 36,994,305 E1231D probably benign Het
Catsperg1 A T 7: 29,191,737 M627K probably benign Het
Ccdc114 T G 7: 45,936,564 C128W probably damaging Het
Cdk7 G A 13: 100,717,618 T121I probably benign Het
Csmd3 T A 15: 47,659,042 T1833S Het
Dapk3 A T 10: 81,192,432 R279W probably damaging Het
Dnah9 T C 11: 66,108,030 E1064G probably damaging Het
Dner T C 1: 84,695,505 E75G probably benign Het
Dnmt1 T C 9: 20,936,559 E229G possibly damaging Het
Fam171a1 G A 2: 3,226,397 A856T probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fen1 A T 19: 10,200,942 V46D probably damaging Het
Ffar3 T C 7: 30,855,029 R289G probably damaging Het
Fhod3 G A 18: 25,110,079 E1165K possibly damaging Het
Fras1 A T 5: 96,636,064 H809L probably damaging Het
Gbp7 A T 3: 142,544,109 E447V probably benign Het
Gja8 T C 3: 96,920,205 D47G probably damaging Het
Gm13089 T C 4: 143,697,329 I297V possibly damaging Het
Gm5795 A G 14: 3,191,110 K144E probably benign Het
Gm7298 A C 6: 121,781,841 Q1139H possibly damaging Het
Gpa33 A T 1: 166,165,161 Y281F probably damaging Het
H2-M10.5 G A 17: 36,773,334 E63K possibly damaging Het
Hgf T C 5: 16,618,958 W718R probably damaging Het
Ifna5 C G 4: 88,835,809 D95E probably benign Het
Ifnar2 T C 16: 91,404,185 L438P possibly damaging Het
Ints1 T C 5: 139,758,571 T1479A probably benign Het
Kif1a C T 1: 93,025,673 R1263H probably damaging Het
Ltbp2 T C 12: 84,809,693 T686A probably benign Het
Med12l A T 3: 59,255,873 E1307V probably damaging Het
Mtcl1 T A 17: 66,344,067 T1468S probably damaging Het
Myo9a C T 9: 59,868,144 Q1013* probably null Het
Nckap5 T C 1: 126,695,754 M1V probably null Het
Nos3 G T 5: 24,383,641 V1122F probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr658 A T 7: 104,644,621 C250* probably null Het
Oscar A G 7: 3,616,073 V2A probably benign Het
P2rx6 T A 16: 17,567,440 H132Q possibly damaging Het
Pakap T C 4: 57,637,857 C12R unknown Het
Pde6b T A 5: 108,388,726 M96K possibly damaging Het
Polq T A 16: 37,022,797 L231Q probably damaging Het
Prrc2a G A 17: 35,159,868 T399I unknown Het
Rapsn A G 2: 91,036,827 D158G probably damaging Het
Sema4d G T 13: 51,713,758 P186T probably damaging Het
Skiv2l A C 17: 34,844,664 L601R probably damaging Het
Slc4a7 G A 14: 14,773,241 R737Q probably damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Sox15 T G 11: 69,655,703 Y111D probably damaging Het
Spen C T 4: 141,473,627 C2563Y probably damaging Het
St5 A C 7: 109,540,435 D645E possibly damaging Het
Taf8 A T 17: 47,496,602 D153E probably damaging Het
Tet3 G A 6: 83,368,271 A1728V probably damaging Het
Tmem232 A T 17: 65,430,783 D427E probably benign Het
Tmem53 T C 4: 117,268,254 I188T probably benign Het
Tnc T G 4: 64,017,094 D535A probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Tnik G A 3: 28,638,395 G867R probably damaging Het
Uba3 A T 6: 97,185,733 C367* probably null Het
Vmn1r235 G T 17: 21,261,707 S98I possibly damaging Het
Vmn2r15 T C 5: 109,294,243 E108G probably benign Het
Xrra1 T A 7: 99,876,255 I127N probably benign Het
Zc3h18 G A 8: 122,403,224 R447Q unknown Het
Zcwpw1 C A 5: 137,800,078 P179Q probably damaging Het
Zfp526 C T 7: 25,225,839 H508Y probably damaging Het
Zfp583 T C 7: 6,317,405 K203E probably benign Het
Zfp979 A G 4: 147,613,047 C402R possibly damaging Het
Zxdc A G 6: 90,382,272 T629A probably damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTCTTAGCATGCCATG -3'
(R):5'- ATGCTAGTCATGGTCCAGCC -3'

Sequencing Primer
(F):5'- GTCGATAAACCGGTCAGT -3'
(R):5'- AGTAGAAACTGACTTGACTTTTGGGC -3'
Posted On 2021-10-11