Mutagenetix > Incidental Mutation

Incidental Mutation 'R9017:Dsc2'

686103

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9017 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20043911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 360 (Y360N)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: Y360N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Y360N

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: Y360N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Y360N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	T	C	16: 56,732,848	T629A	probably benign	Het
Afg3l2	A	G	18: 67,409,480	V632A	possibly damaging	Het
Ahnak	G	A	19: 9,010,123	E2924K	probably damaging	Het
Ampd1	A	G	3: 103,088,470	Y232C	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Atp8b4	A	T	2: 126,433,921	N130K	probably benign	Het
Cdh15	T	C	8: 122,857,517		probably null	Het
Cep70	T	C	9: 99,299,776	I613T	possibly damaging	Het
Cfap54	C	T	10: 92,816,021	V3056I	probably benign	Het
Chrna2	T	C	14: 66,148,833	F143L	probably benign	Het
Cmya5	C	T	13: 93,092,064	R2172H	probably benign	Het
Col17a1	T	C	19: 47,669,459	E424G	probably benign	Het
Crybg1	T	C	10: 44,004,481	E237G	probably benign	Het
Ctnnd2	G	A	15: 30,881,170	C732Y	probably damaging	Het
Dcaf12	T	C	4: 41,299,411	N264S	probably benign	Het
Dennd4c	A	G	4: 86,825,112	S1064G	probably benign	Het
E2f3	T	G	13: 29,913,495	D295A	probably damaging	Het
Eef2	T	C	10: 81,179,653	L336P	possibly damaging	Het
Fanca	A	G	8: 123,308,568	S213P	possibly damaging	Het
Fpgt	A	T	3: 155,087,266	S375T	probably benign	Het
Gad1	G	A	2: 70,585,862	V222I	probably benign	Het
Gm5930	A	T	14: 44,331,401	Y255N	possibly damaging	Het
Gpr55	T	C	1: 85,940,902	N319S	probably benign	Het
Grik2	T	A	10: 49,113,459	I825F	possibly damaging	Het
Hcn4	T	C	9: 58,824,199	S230P	unknown	Het
Kansl3	T	C	1: 36,354,780	I222V	probably benign	Het
Kif20b	T	C	19: 34,949,803	S822P	probably benign	Het
Kremen2	T	A	17: 23,745,763		probably benign	Het
Krt71	G	T	15: 101,742,665	R128S	possibly damaging	Het
Lrp4	A	T	2: 91,494,052	N1244I	possibly damaging	Het
Lrrc66	T	C	5: 73,607,901	S600G	possibly damaging	Het
Mrc2	T	A	11: 105,325,885	C167S	probably damaging	Het
Mrps17	T	C	5: 129,716,793	V17A	probably damaging	Het
Muc20	A	T	16: 32,794,470	L179Q	unknown	Het
Olfr1209	G	T	2: 88,909,607	T262K	probably damaging	Het
Olfr1340	T	A	4: 118,726,368	F40L	probably benign	Het
Olfr309	A	T	7: 86,306,749	Y121*	probably null	Het
Otop2	T	C	11: 115,323,605	F63L	probably benign	Het
Pde3b	C	T	7: 114,416,460	Q304*	probably null	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Plekhg4	A	G	8: 105,378,700	E599G	possibly damaging	Het
Ppargc1a	C	A	5: 51,472,909	R622L	unknown	Het
Ppip5k2	A	G	1: 97,727,414	L879P	probably damaging	Het
Prepl	C	T	17: 85,068,938	V563M	possibly damaging	Het
Prom1	G	T	5: 44,047,528	D201E	probably damaging	Het
Psmd1	T	A	1: 86,126,509	D723E	probably damaging	Het
Sall2	A	T	14: 52,313,262	N825K	possibly damaging	Het
Sds	A	T	5: 120,480,590	M70L	probably benign	Het
Sema4c	C	T	1: 36,552,998	R256H	probably damaging	Het
Sik1	T	C	17: 31,851,571	Y100C	probably damaging	Het
Slc13a5	T	A	11: 72,247,762	I452F	probably damaging	Het
Slc25a24	A	G	3: 109,155,079	I162V	possibly damaging	Het
Sorbs2	T	G	8: 45,795,737	V675G	probably benign	Het
Tenm3	T	A	8: 48,254,633	N1710I	probably damaging	Het
Tmem115	T	A	9: 107,534,681	M68K	probably benign	Het
Tmem132d	T	C	5: 127,789,872	I655V	probably benign	Het
Tmem132d	T	C	5: 128,269,252	I69V	probably benign	Het
Tnfrsf11a	G	A	1: 105,827,129	A309T	possibly damaging	Het
Trim9	A	G	12: 70,267,239	M544T	probably benign	Het
Ttll3	G	A	6: 113,412,889	R745H	probably benign	Het
Ttn	G	T	2: 76,907,587	L4249I	unknown	Het
Unc79	G	A	12: 103,108,615		probably null	Het
Vmn1r196	T	C	13: 22,294,084	C298R	probably benign	Het
Vmn1r216	A	G	13: 23,099,911	I255V	probably benign	Het
Zfp853	A	G	5: 143,288,488	L474P	unknown	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGCCTTCATTGGTTTTAGGATC -3'
(R):5'- ACTACGGTAAGTGTGTGCTG -3'

Sequencing Primer
(F):5'- CCTTCATTGGTTTTAGGATCTGTTAC -3'
(R):5'- GTGCTGTTTACTAGAGAGAAATGC -3'

Posted On

2021-10-11