Incidental Mutation 'R9017:Dsc2'
ID 686103
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9017 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20030633-20059554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20043911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 360 (Y360N)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably damaging
Transcript: ENSMUST00000039247
AA Change: Y360N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Y360N

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075214
AA Change: Y360N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Y360N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,848 T629A probably benign Het
Afg3l2 A G 18: 67,409,480 V632A possibly damaging Het
Ahnak G A 19: 9,010,123 E2924K probably damaging Het
Ampd1 A G 3: 103,088,470 Y232C probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Atp8b4 A T 2: 126,433,921 N130K probably benign Het
Cdh15 T C 8: 122,857,517 probably null Het
Cep70 T C 9: 99,299,776 I613T possibly damaging Het
Cfap54 C T 10: 92,816,021 V3056I probably benign Het
Chrna2 T C 14: 66,148,833 F143L probably benign Het
Cmya5 C T 13: 93,092,064 R2172H probably benign Het
Col17a1 T C 19: 47,669,459 E424G probably benign Het
Crybg1 T C 10: 44,004,481 E237G probably benign Het
Ctnnd2 G A 15: 30,881,170 C732Y probably damaging Het
Dcaf12 T C 4: 41,299,411 N264S probably benign Het
Dennd4c A G 4: 86,825,112 S1064G probably benign Het
E2f3 T G 13: 29,913,495 D295A probably damaging Het
Eef2 T C 10: 81,179,653 L336P possibly damaging Het
Fanca A G 8: 123,308,568 S213P possibly damaging Het
Fpgt A T 3: 155,087,266 S375T probably benign Het
Gad1 G A 2: 70,585,862 V222I probably benign Het
Gm5930 A T 14: 44,331,401 Y255N possibly damaging Het
Gpr55 T C 1: 85,940,902 N319S probably benign Het
Grik2 T A 10: 49,113,459 I825F possibly damaging Het
Hcn4 T C 9: 58,824,199 S230P unknown Het
Kansl3 T C 1: 36,354,780 I222V probably benign Het
Kif20b T C 19: 34,949,803 S822P probably benign Het
Kremen2 T A 17: 23,745,763 probably benign Het
Krt71 G T 15: 101,742,665 R128S possibly damaging Het
Lrp4 A T 2: 91,494,052 N1244I possibly damaging Het
Lrrc66 T C 5: 73,607,901 S600G possibly damaging Het
Mrc2 T A 11: 105,325,885 C167S probably damaging Het
Mrps17 T C 5: 129,716,793 V17A probably damaging Het
Muc20 A T 16: 32,794,470 L179Q unknown Het
Olfr1209 G T 2: 88,909,607 T262K probably damaging Het
Olfr1340 T A 4: 118,726,368 F40L probably benign Het
Olfr309 A T 7: 86,306,749 Y121* probably null Het
Otop2 T C 11: 115,323,605 F63L probably benign Het
Pde3b C T 7: 114,416,460 Q304* probably null Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Plekhg4 A G 8: 105,378,700 E599G possibly damaging Het
Ppargc1a C A 5: 51,472,909 R622L unknown Het
Ppip5k2 A G 1: 97,727,414 L879P probably damaging Het
Prepl C T 17: 85,068,938 V563M possibly damaging Het
Prom1 G T 5: 44,047,528 D201E probably damaging Het
Psmd1 T A 1: 86,126,509 D723E probably damaging Het
Sall2 A T 14: 52,313,262 N825K possibly damaging Het
Sds A T 5: 120,480,590 M70L probably benign Het
Sema4c C T 1: 36,552,998 R256H probably damaging Het
Sik1 T C 17: 31,851,571 Y100C probably damaging Het
Slc13a5 T A 11: 72,247,762 I452F probably damaging Het
Slc25a24 A G 3: 109,155,079 I162V possibly damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tenm3 T A 8: 48,254,633 N1710I probably damaging Het
Tmem115 T A 9: 107,534,681 M68K probably benign Het
Tmem132d T C 5: 127,789,872 I655V probably benign Het
Tmem132d T C 5: 128,269,252 I69V probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Trim9 A G 12: 70,267,239 M544T probably benign Het
Ttll3 G A 6: 113,412,889 R745H probably benign Het
Ttn G T 2: 76,907,587 L4249I unknown Het
Unc79 G A 12: 103,108,615 probably null Het
Vmn1r196 T C 13: 22,294,084 C298R probably benign Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Zfp853 A G 5: 143,288,488 L474P unknown Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
R9005:Dsc2 UTSW 18 20038094 missense probably benign 0.00
R9111:Dsc2 UTSW 18 20034707 missense probably benign 0.00
R9396:Dsc2 UTSW 18 20041716 nonsense probably null
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCCTTCATTGGTTTTAGGATC -3'
(R):5'- ACTACGGTAAGTGTGTGCTG -3'

Sequencing Primer
(F):5'- CCTTCATTGGTTTTAGGATCTGTTAC -3'
(R):5'- GTGCTGTTTACTAGAGAGAAATGC -3'
Posted On 2021-10-11