Incidental Mutation 'R9017:Afg3l2'
ID 686104
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9017 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67409480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 632 (V632A)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000025408
AA Change: V632A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: V632A

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,848 T629A probably benign Het
Ahnak G A 19: 9,010,123 E2924K probably damaging Het
Ampd1 A G 3: 103,088,470 Y232C probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Atp8b4 A T 2: 126,433,921 N130K probably benign Het
Cdh15 T C 8: 122,857,517 probably null Het
Cep70 T C 9: 99,299,776 I613T possibly damaging Het
Cfap54 C T 10: 92,816,021 V3056I probably benign Het
Chrna2 T C 14: 66,148,833 F143L probably benign Het
Cmya5 C T 13: 93,092,064 R2172H probably benign Het
Col17a1 T C 19: 47,669,459 E424G probably benign Het
Crybg1 T C 10: 44,004,481 E237G probably benign Het
Ctnnd2 G A 15: 30,881,170 C732Y probably damaging Het
Dcaf12 T C 4: 41,299,411 N264S probably benign Het
Dennd4c A G 4: 86,825,112 S1064G probably benign Het
Dsc2 A T 18: 20,043,911 Y360N probably damaging Het
E2f3 T G 13: 29,913,495 D295A probably damaging Het
Eef2 T C 10: 81,179,653 L336P possibly damaging Het
Fanca A G 8: 123,308,568 S213P possibly damaging Het
Fpgt A T 3: 155,087,266 S375T probably benign Het
Gad1 G A 2: 70,585,862 V222I probably benign Het
Gm5930 A T 14: 44,331,401 Y255N possibly damaging Het
Gpr55 T C 1: 85,940,902 N319S probably benign Het
Grik2 T A 10: 49,113,459 I825F possibly damaging Het
Hcn4 T C 9: 58,824,199 S230P unknown Het
Kansl3 T C 1: 36,354,780 I222V probably benign Het
Kif20b T C 19: 34,949,803 S822P probably benign Het
Kremen2 T A 17: 23,745,763 probably benign Het
Krt71 G T 15: 101,742,665 R128S possibly damaging Het
Lrp4 A T 2: 91,494,052 N1244I possibly damaging Het
Lrrc66 T C 5: 73,607,901 S600G possibly damaging Het
Mrc2 T A 11: 105,325,885 C167S probably damaging Het
Mrps17 T C 5: 129,716,793 V17A probably damaging Het
Muc20 A T 16: 32,794,470 L179Q unknown Het
Olfr1209 G T 2: 88,909,607 T262K probably damaging Het
Olfr1340 T A 4: 118,726,368 F40L probably benign Het
Olfr309 A T 7: 86,306,749 Y121* probably null Het
Otop2 T C 11: 115,323,605 F63L probably benign Het
Pde3b C T 7: 114,416,460 Q304* probably null Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Plekhg4 A G 8: 105,378,700 E599G possibly damaging Het
Ppargc1a C A 5: 51,472,909 R622L unknown Het
Ppip5k2 A G 1: 97,727,414 L879P probably damaging Het
Prepl C T 17: 85,068,938 V563M possibly damaging Het
Prom1 G T 5: 44,047,528 D201E probably damaging Het
Psmd1 T A 1: 86,126,509 D723E probably damaging Het
Sall2 A T 14: 52,313,262 N825K possibly damaging Het
Sds A T 5: 120,480,590 M70L probably benign Het
Sema4c C T 1: 36,552,998 R256H probably damaging Het
Sik1 T C 17: 31,851,571 Y100C probably damaging Het
Slc13a5 T A 11: 72,247,762 I452F probably damaging Het
Slc25a24 A G 3: 109,155,079 I162V possibly damaging Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Tenm3 T A 8: 48,254,633 N1710I probably damaging Het
Tmem115 T A 9: 107,534,681 M68K probably benign Het
Tmem132d T C 5: 127,789,872 I655V probably benign Het
Tmem132d T C 5: 128,269,252 I69V probably benign Het
Tnfrsf11a G A 1: 105,827,129 A309T possibly damaging Het
Trim9 A G 12: 70,267,239 M544T probably benign Het
Ttll3 G A 6: 113,412,889 R745H probably benign Het
Ttn G T 2: 76,907,587 L4249I unknown Het
Unc79 G A 12: 103,108,615 probably null Het
Vmn1r196 T C 13: 22,294,084 C298R probably benign Het
Vmn1r216 A G 13: 23,099,911 I255V probably benign Het
Zfp853 A G 5: 143,288,488 L474P unknown Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GATCTAAGACTCTCTGCTGCAG -3'
(R):5'- TGTGCTGCCCTTTCATCAGG -3'

Sequencing Primer
(F):5'- TGCTGCAGAAACCTTACTCAGTG -3'
(R):5'- CCTTTCATCAGGGAGTGTCCG -3'
Posted On 2021-10-11