Incidental Mutation 'R9018:Pole'
ID 686123
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Name polymerase (DNA directed), epsilon
Synonyms pol-epsilon
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110434185-110485319 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110437675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 78 (L78I)
Ref Sequence ENSEMBL: ENSMUSP00000007296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000031472] [ENSMUST00000112482] [ENSMUST00000155266]
AlphaFold Q9WVF7
Predicted Effect probably benign
Transcript: ENSMUST00000007296
AA Change: L78I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: L78I

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031472
SMART Domains Protein: ENSMUSP00000031472
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Mpv17_PMP22 128 192 2.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112482
AA Change: L78I

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080
AA Change: L78I

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 86 190 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155266
SMART Domains Protein: ENSMUSP00000117729
Gene: ENSMUSG00000029499

DomainStartEndE-ValueType
low complexity region 17 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Greb1l T A 18: 10,542,004 (GRCm39) D1250E possibly damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mapk13 C T 17: 28,996,760 (GRCm39) R276C probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5b118 A T 19: 13,448,721 (GRCm39) H87L possibly damaging Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
Smarca5 A G 8: 81,431,355 (GRCm39) L954P probably damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Stim1 C T 7: 102,060,482 (GRCm39) T175I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110,451,431 (GRCm39) splice site probably benign
IGL00475:Pole APN 5 110,438,962 (GRCm39) nonsense probably null
IGL00837:Pole APN 5 110,449,875 (GRCm39) missense possibly damaging 0.91
IGL00976:Pole APN 5 110,471,438 (GRCm39) missense probably benign 0.00
IGL01081:Pole APN 5 110,485,106 (GRCm39) missense possibly damaging 0.92
IGL01503:Pole APN 5 110,451,750 (GRCm39) missense probably damaging 1.00
IGL01640:Pole APN 5 110,446,132 (GRCm39) missense probably null 0.08
IGL01987:Pole APN 5 110,485,098 (GRCm39) missense probably benign 0.01
IGL02429:Pole APN 5 110,447,666 (GRCm39) missense probably benign
IGL02733:Pole APN 5 110,460,594 (GRCm39) splice site probably benign
IGL03102:Pole APN 5 110,444,939 (GRCm39) missense probably damaging 1.00
IGL03157:Pole APN 5 110,441,619 (GRCm39) missense probably benign
IGL03186:Pole APN 5 110,447,786 (GRCm39) critical splice donor site probably null
IGL03271:Pole APN 5 110,466,185 (GRCm39) missense probably benign
IGL03351:Pole APN 5 110,449,864 (GRCm39) splice site probably benign
IGL03408:Pole APN 5 110,442,426 (GRCm39) missense probably damaging 1.00
IGL03410:Pole APN 5 110,472,425 (GRCm39) missense probably benign
ANU74:Pole UTSW 5 110,437,236 (GRCm39) missense probably benign 0.44
PIT4495001:Pole UTSW 5 110,451,780 (GRCm39) missense probably damaging 1.00
R0053:Pole UTSW 5 110,441,206 (GRCm39) missense probably damaging 1.00
R0053:Pole UTSW 5 110,441,206 (GRCm39) missense probably damaging 1.00
R0124:Pole UTSW 5 110,451,858 (GRCm39) missense probably damaging 0.96
R0145:Pole UTSW 5 110,472,291 (GRCm39) missense probably damaging 0.99
R0523:Pole UTSW 5 110,451,459 (GRCm39) missense probably damaging 0.96
R0590:Pole UTSW 5 110,465,792 (GRCm39) missense probably benign
R0625:Pole UTSW 5 110,473,416 (GRCm39) missense possibly damaging 0.50
R0707:Pole UTSW 5 110,446,854 (GRCm39) missense probably damaging 1.00
R1160:Pole UTSW 5 110,443,119 (GRCm39) missense possibly damaging 0.85
R1320:Pole UTSW 5 110,456,995 (GRCm39) frame shift probably null
R1384:Pole UTSW 5 110,471,530 (GRCm39) missense possibly damaging 0.81
R1626:Pole UTSW 5 110,441,235 (GRCm39) missense probably benign 0.25
R1643:Pole UTSW 5 110,465,711 (GRCm39) missense probably damaging 1.00
R1655:Pole UTSW 5 110,483,788 (GRCm39) missense probably damaging 1.00
R1668:Pole UTSW 5 110,445,235 (GRCm39) missense probably damaging 1.00
R1783:Pole UTSW 5 110,445,296 (GRCm39) missense probably damaging 1.00
R1843:Pole UTSW 5 110,478,701 (GRCm39) critical splice donor site probably null
R1853:Pole UTSW 5 110,454,719 (GRCm39) missense possibly damaging 0.95
R1867:Pole UTSW 5 110,482,063 (GRCm39) missense probably benign 0.08
R1874:Pole UTSW 5 110,471,530 (GRCm39) missense possibly damaging 0.81
R1891:Pole UTSW 5 110,480,408 (GRCm39) missense probably damaging 1.00
R1928:Pole UTSW 5 110,475,644 (GRCm39) missense probably benign
R2073:Pole UTSW 5 110,473,417 (GRCm39) missense probably damaging 0.99
R2341:Pole UTSW 5 110,478,829 (GRCm39) missense possibly damaging 0.67
R2448:Pole UTSW 5 110,444,958 (GRCm39) missense probably damaging 1.00
R2504:Pole UTSW 5 110,438,368 (GRCm39) splice site probably null
R3053:Pole UTSW 5 110,437,661 (GRCm39) missense probably damaging 1.00
R3892:Pole UTSW 5 110,484,305 (GRCm39) missense probably damaging 1.00
R3964:Pole UTSW 5 110,460,648 (GRCm39) missense probably damaging 1.00
R3965:Pole UTSW 5 110,460,648 (GRCm39) missense probably damaging 1.00
R4374:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4376:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4377:Pole UTSW 5 110,485,071 (GRCm39) missense possibly damaging 0.89
R4520:Pole UTSW 5 110,445,790 (GRCm39) missense probably damaging 1.00
R4670:Pole UTSW 5 110,454,253 (GRCm39) missense probably benign 0.01
R4778:Pole UTSW 5 110,478,698 (GRCm39) missense probably benign 0.00
R4887:Pole UTSW 5 110,472,619 (GRCm39) missense probably damaging 0.99
R4898:Pole UTSW 5 110,438,090 (GRCm39) critical splice acceptor site probably null
R5184:Pole UTSW 5 110,442,800 (GRCm39) missense possibly damaging 0.91
R5359:Pole UTSW 5 110,480,354 (GRCm39) missense probably benign 0.03
R5483:Pole UTSW 5 110,442,434 (GRCm39) missense probably damaging 1.00
R5529:Pole UTSW 5 110,480,332 (GRCm39) missense probably benign 0.20
R5576:Pole UTSW 5 110,459,931 (GRCm39) nonsense probably null
R5817:Pole UTSW 5 110,460,838 (GRCm39) missense probably damaging 1.00
R5877:Pole UTSW 5 110,480,329 (GRCm39) missense probably benign
R5956:Pole UTSW 5 110,485,153 (GRCm39) unclassified probably benign
R5990:Pole UTSW 5 110,450,010 (GRCm39) missense probably damaging 1.00
R6019:Pole UTSW 5 110,472,381 (GRCm39) missense probably benign 0.01
R6019:Pole UTSW 5 110,472,380 (GRCm39) missense probably benign 0.01
R6093:Pole UTSW 5 110,459,956 (GRCm39) missense probably benign 0.01
R6376:Pole UTSW 5 110,484,240 (GRCm39) missense probably damaging 0.99
R6494:Pole UTSW 5 110,472,588 (GRCm39) missense possibly damaging 0.86
R6535:Pole UTSW 5 110,472,673 (GRCm39) missense probably damaging 1.00
R6723:Pole UTSW 5 110,471,482 (GRCm39) missense probably benign 0.11
R6757:Pole UTSW 5 110,451,476 (GRCm39) missense probably damaging 1.00
R6930:Pole UTSW 5 110,441,156 (GRCm39) missense probably benign 0.01
R6988:Pole UTSW 5 110,477,449 (GRCm39) missense probably damaging 0.97
R6992:Pole UTSW 5 110,480,365 (GRCm39) missense probably damaging 0.99
R7067:Pole UTSW 5 110,482,084 (GRCm39) missense probably damaging 1.00
R7097:Pole UTSW 5 110,472,968 (GRCm39) splice site probably null
R7122:Pole UTSW 5 110,472,968 (GRCm39) splice site probably null
R7202:Pole UTSW 5 110,444,973 (GRCm39) missense possibly damaging 0.94
R7340:Pole UTSW 5 110,482,330 (GRCm39) missense probably benign 0.06
R7345:Pole UTSW 5 110,451,769 (GRCm39) missense possibly damaging 0.82
R7509:Pole UTSW 5 110,478,571 (GRCm39) start gained probably benign
R7557:Pole UTSW 5 110,460,860 (GRCm39) missense probably damaging 1.00
R7740:Pole UTSW 5 110,478,907 (GRCm39) missense probably benign 0.00
R7792:Pole UTSW 5 110,445,332 (GRCm39) splice site probably null
R7832:Pole UTSW 5 110,465,663 (GRCm39) missense probably benign 0.00
R7849:Pole UTSW 5 110,480,414 (GRCm39) missense probably benign 0.04
R7852:Pole UTSW 5 110,454,695 (GRCm39) missense probably damaging 1.00
R7960:Pole UTSW 5 110,437,727 (GRCm39) missense possibly damaging 0.81
R8001:Pole UTSW 5 110,460,600 (GRCm39) missense probably damaging 1.00
R8266:Pole UTSW 5 110,442,786 (GRCm39) missense probably damaging 1.00
R8510:Pole UTSW 5 110,482,312 (GRCm39) missense probably damaging 0.99
R8793:Pole UTSW 5 110,445,614 (GRCm39) missense probably damaging 1.00
R8835:Pole UTSW 5 110,454,775 (GRCm39) missense probably damaging 1.00
R8863:Pole UTSW 5 110,437,233 (GRCm39) missense possibly damaging 0.94
R8929:Pole UTSW 5 110,445,654 (GRCm39) missense probably damaging 0.98
R8968:Pole UTSW 5 110,459,949 (GRCm39) missense possibly damaging 0.78
R8992:Pole UTSW 5 110,471,488 (GRCm39) missense possibly damaging 0.88
R9177:Pole UTSW 5 110,480,288 (GRCm39) missense probably benign 0.04
R9250:Pole UTSW 5 110,447,687 (GRCm39) missense possibly damaging 0.88
R9262:Pole UTSW 5 110,473,423 (GRCm39) missense probably damaging 1.00
R9262:Pole UTSW 5 110,473,422 (GRCm39) missense probably damaging 0.99
R9367:Pole UTSW 5 110,444,955 (GRCm39) missense probably damaging 0.99
R9383:Pole UTSW 5 110,438,892 (GRCm39) missense possibly damaging 0.61
R9626:Pole UTSW 5 110,459,959 (GRCm39) missense possibly damaging 0.68
R9676:Pole UTSW 5 110,443,431 (GRCm39) missense probably benign 0.00
R9720:Pole UTSW 5 110,484,909 (GRCm39) missense probably benign 0.01
R9787:Pole UTSW 5 110,465,866 (GRCm39) critical splice donor site probably null
R9794:Pole UTSW 5 110,466,201 (GRCm39) missense probably benign 0.01
X0064:Pole UTSW 5 110,465,770 (GRCm39) nonsense probably null
Y5377:Pole UTSW 5 110,442,757 (GRCm39) critical splice acceptor site probably null
Y5380:Pole UTSW 5 110,442,757 (GRCm39) critical splice acceptor site probably null
Z1088:Pole UTSW 5 110,475,731 (GRCm39) missense possibly damaging 0.66
Z1177:Pole UTSW 5 110,444,875 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTCTTACAAAGGTGGTGTC -3'
(R):5'- AAGTGATGAGCAACCTGGAC -3'

Sequencing Primer
(F):5'- CTTACAAAGGTGGTGTCTATGTAAG -3'
(R):5'- AAGGCGCCTTGGACCTTGATAG -3'
Posted On 2021-10-11