Mutagenetix > Incidental Mutation

Incidental Mutation 'R9018:Pole'

686123

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

068848-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110289809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 78 (L78I)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000031472] [ENSMUST00000112482] [ENSMUST00000155266]

AlphaFold

Q9WVF7

Predicted Effect

probably benign
Transcript: ENSMUST00000007296
AA Change: L78I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: L78I

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000031472

SMART Domains

Protein: ENSMUSP00000031472
Gene: ENSMUSG00000029499

Domain	Start	End	E-Value	Type
low complexity region	17	35	N/A	INTRINSIC
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	113	125	N/A	INTRINSIC
Pfam:Mpv17_PMP22	128	192	2.7e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112482
AA Change: L78I

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108101
Gene: ENSMUSG00000007080
AA Change: L78I

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	86	190	1.5e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155266

SMART Domains

Protein: ENSMUSP00000117729
Gene: ENSMUSG00000029499

Domain	Start	End	E-Value	Type
low complexity region	17	35	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,289,540	K1236N	probably benign	Het
Abca14	A	G	7: 120,319,309	E1552G	probably damaging	Het
Adam3	A	T	8: 24,694,276	Y569*	probably null	Het
Adgrb2	A	G	4: 130,013,866	T998A	probably benign	Het
Adgre4	T	A	17: 55,791,993	H166Q	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Ankrd11	A	G	8: 122,895,512	S534P	probably damaging	Het
Atn1	C	T	6: 124,745,698	E805K	unknown	Het
Bsn	T	C	9: 108,117,289	T596A	probably benign	Het
Cacnb4	C	T	2: 52,434,694	R452Q	probably benign	Het
Cdc123	C	A	2: 5,844,872	A13S	probably benign	Het
Chd7	G	A	4: 8,847,083	G1609S	possibly damaging	Het
Cp	T	A	3: 19,989,152	C1035S	probably damaging	Het
Dcaf1	T	A	9: 106,865,637	C1383S	probably damaging	Het
Derl3	G	A	10: 75,893,770	V54I	probably benign	Het
Dgcr6	T	C	16: 18,066,743	L25P	probably damaging	Het
Dmrt2	A	G	19: 25,673,621	E57G	probably benign	Het
Dst	A	G	1: 34,196,059	K3562E	probably damaging	Het
Dyrk2	T	C	10: 118,860,109	T415A	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbln1	T	C	15: 85,242,014	I484T	probably damaging	Het
Greb1l	T	A	18: 10,542,004	D1250E	possibly damaging	Het
Ift88	A	C	14: 57,438,245	K72Q	probably benign	Het
Impg1	T	A	9: 80,394,192	I228F	probably benign	Het
Itsn2	A	G	12: 4,658,091	N799S	possibly damaging	Het
Jade1	T	A	3: 41,609,857	C521S	probably benign	Het
Katna1	T	G	10: 7,761,276	L397R	probably damaging	Het
Kcnj15	A	C	16: 95,296,270	K250N	probably damaging	Het
Lrrc6	A	T	15: 66,449,630	S221T	probably benign	Het
Macc1	A	G	12: 119,446,206	I236M	possibly damaging	Het
Mapk13	C	T	17: 28,777,786	R276C	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mindy4	C	T	6: 55,301,087	H639Y	possibly damaging	Het
Mphosph9	A	G	5: 124,298,650	S544P	probably benign	Het
Muc4	T	C	16: 32,762,536	Y492H		Het
Mybbp1a	C	T	11: 72,443,594	T225I	probably benign	Het
Myo6	A	T	9: 80,251,804	K285I	unknown	Het
Nmd3	G	A	3: 69,739,995	V277I	probably benign	Het
Nol9	G	C	4: 152,039,461	R36P	probably damaging	Het
Nom1	A	G	5: 29,434,714	R13G	possibly damaging	Het
Nudt14	G	A	12: 112,939,286	H40Y	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr1474	A	T	19: 13,471,357	H87L	possibly damaging	Het
Olfr933	T	A	9: 38,976,391	F238L	probably benign	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pgghg	A	G	7: 140,944,666	I309V	probably benign	Het
Phf12	C	T	11: 78,023,684	P651S	possibly damaging	Het
Pltp	A	G	2: 164,852,490	L199P	probably damaging	Het
Ppm1d	C	A	11: 85,337,135	H292Q	probably damaging	Het
Ppp2cb	A	C	8: 33,615,759	I224L	probably benign	Het
Rabggta	A	T	14: 55,720,423	I171N	probably damaging	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rb1cc1	G	A	1: 6,249,266	E970K	probably benign	Het
Rnh1	A	T	7: 141,168,631	V11D	probably benign	Het
Robo4	C	T	9: 37,404,224	T288I	probably benign	Het
Scmh1	A	G	4: 120,505,317	D250G	probably benign	Het
Sele	T	A	1: 164,053,679	C483S	probably damaging	Het
Slc12a6	A	G	2: 112,344,240		probably benign	Het
Slc5a4a	A	G	10: 76,166,712	E234G	possibly damaging	Het
Smarca5	A	G	8: 80,704,726	L954P	probably damaging	Het
St7	T	A	6: 17,906,495	N413K	probably damaging	Het
Stam2	C	T	2: 52,716,451	V141I	probably benign	Het
Stim1	C	T	7: 102,411,275	T175I	probably benign	Het
Strap	A	G	6: 137,739,813	N130S	probably benign	Het
Stxbp2	A	G	8: 3,642,627		probably benign	Het
Sult3a2	T	A	10: 33,779,693	I97F	probably benign	Het
Tbc1d32	A	T	10: 56,072,597	N965K	probably benign	Het
Tle3	T	A	9: 61,412,468	I506N	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tvp23a	A	G	16: 10,446,982	S22P	probably damaging	Het
Vmn2r82	A	G	10: 79,396,705	N846S	probably damaging	Het
Vmn2r83	A	G	10: 79,480,186	N472S	probably damaging	Het
Xpo7	G	A	14: 70,707,424	Q10*	probably null	Het
Zfp423	G	C	8: 87,781,753	S654R	probably benign	Het
Zfp646	A	T	7: 127,879,071	H140L	probably benign	Het
Zfp719	C	A	7: 43,584,065		probably benign	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
R9626:Pole	UTSW	5	110312093	missense	possibly damaging	0.68
R9676:Pole	UTSW	5	110295565	missense	probably benign	0.00
R9720:Pole	UTSW	5	110337043	missense	probably benign	0.01
R9787:Pole	UTSW	5	110318000	critical splice donor site	probably null
R9794:Pole	UTSW	5	110318335	missense	probably benign	0.01
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTTCTTACAAAGGTGGTGTC -3'
(R):5'- AAGTGATGAGCAACCTGGAC -3'

Sequencing Primer
(F):5'- CTTACAAAGGTGGTGTCTATGTAAG -3'
(R):5'- AAGGCGCCTTGGACCTTGATAG -3'

Posted On

2021-10-11