Incidental Mutation 'R9018:Stim1'
ID 686128
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 101917013-102086526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102060482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 175 (T175I)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
AA Change: T175I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: T175I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
AA Change: T175I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: T175I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Greb1l T A 18: 10,542,004 (GRCm39) D1250E possibly damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mapk13 C T 17: 28,996,760 (GRCm39) R276C probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5b118 A T 19: 13,448,721 (GRCm39) H87L possibly damaging Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Pole T A 5: 110,437,675 (GRCm39) L78I probably benign Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
Smarca5 A G 8: 81,431,355 (GRCm39) L954P probably damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102,075,954 (GRCm39) missense probably damaging 1.00
IGL01390:Stim1 APN 7 102,076,369 (GRCm39) missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102,075,176 (GRCm39) splice site probably benign
IGL01826:Stim1 APN 7 102,076,282 (GRCm39) splice site probably benign
IGL01908:Stim1 APN 7 102,084,857 (GRCm39) missense probably benign
IGL02869:Stim1 APN 7 101,917,758 (GRCm39) missense unknown
IGL03146:Stim1 APN 7 102,070,562 (GRCm39) missense probably damaging 1.00
R0217:Stim1 UTSW 7 102,085,007 (GRCm39) missense probably benign 0.00
R1320:Stim1 UTSW 7 102,057,613 (GRCm39) missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102,003,748 (GRCm39) missense probably benign 0.31
R1643:Stim1 UTSW 7 102,035,307 (GRCm39) missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102,003,713 (GRCm39) missense probably damaging 1.00
R2424:Stim1 UTSW 7 102,057,612 (GRCm39) missense probably benign 0.03
R3838:Stim1 UTSW 7 102,060,503 (GRCm39) missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102,084,848 (GRCm39) missense probably benign 0.00
R4820:Stim1 UTSW 7 102,064,571 (GRCm39) missense probably damaging 0.97
R4871:Stim1 UTSW 7 102,003,779 (GRCm39) missense probably damaging 1.00
R5110:Stim1 UTSW 7 101,917,629 (GRCm39) missense unknown
R5787:Stim1 UTSW 7 102,084,647 (GRCm39) missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102,080,157 (GRCm39) missense probably null 0.99
R6788:Stim1 UTSW 7 102,076,498 (GRCm39) missense probably damaging 0.99
R7112:Stim1 UTSW 7 102,057,615 (GRCm39) missense probably benign 0.01
R7125:Stim1 UTSW 7 102,084,741 (GRCm39) missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102,070,739 (GRCm39) critical splice donor site probably null
R7650:Stim1 UTSW 7 102,078,034 (GRCm39) missense
R7807:Stim1 UTSW 7 102,076,348 (GRCm39) missense probably damaging 0.99
R8304:Stim1 UTSW 7 102,084,688 (GRCm39) missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102,076,324 (GRCm39) missense probably damaging 1.00
R8528:Stim1 UTSW 7 102,080,289 (GRCm39) intron probably benign
R8883:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R8921:Stim1 UTSW 7 102,070,597 (GRCm39) missense probably damaging 0.99
R8924:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9164:Stim1 UTSW 7 102,084,626 (GRCm39) missense probably benign 0.35
R9396:Stim1 UTSW 7 102,064,592 (GRCm39) missense possibly damaging 0.63
R9487:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R9501:Stim1 UTSW 7 102,060,506 (GRCm39) missense possibly damaging 0.92
R9697:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9710:Stim1 UTSW 7 102,080,118 (GRCm39) small deletion probably benign
R9734:Stim1 UTSW 7 102,064,560 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCTTGGTAAATACTCCCTGTTAGG -3'
(R):5'- CATTGAGACCCAGGATTCAGC -3'

Sequencing Primer
(F):5'- AATTCCCAGCACCTGTATGGGAG -3'
(R):5'- GGATTCAGCCTAGCCACTC -3'
Posted On 2021-10-11