Mutagenetix > Incidental Mutation

Incidental Mutation 'R9018:Stim1'

686128

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102411275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 175 (T175I)

Ref Sequence

ENSEMBL: ENSMUSP00000033289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

probably benign
Transcript: ENSMUST00000033289
AA Change: T175I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: T175I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209255
AA Change: T175I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000211457
AA Change: T175I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,289,540	K1236N	probably benign	Het
Abca14	A	G	7: 120,319,309	E1552G	probably damaging	Het
Adam3	A	T	8: 24,694,276	Y569*	probably null	Het
Adgrb2	A	G	4: 130,013,866	T998A	probably benign	Het
Adgre4	T	A	17: 55,791,993	H166Q	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Ankrd11	A	G	8: 122,895,512	S534P	probably damaging	Het
Atn1	C	T	6: 124,745,698	E805K	unknown	Het
Bsn	T	C	9: 108,117,289	T596A	probably benign	Het
Cacnb4	C	T	2: 52,434,694	R452Q	probably benign	Het
Cdc123	C	A	2: 5,844,872	A13S	probably benign	Het
Chd7	G	A	4: 8,847,083	G1609S	possibly damaging	Het
Cp	T	A	3: 19,989,152	C1035S	probably damaging	Het
Dcaf1	T	A	9: 106,865,637	C1383S	probably damaging	Het
Derl3	G	A	10: 75,893,770	V54I	probably benign	Het
Dgcr6	T	C	16: 18,066,743	L25P	probably damaging	Het
Dmrt2	A	G	19: 25,673,621	E57G	probably benign	Het
Dst	A	G	1: 34,196,059	K3562E	probably damaging	Het
Dyrk2	T	C	10: 118,860,109	T415A	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbln1	T	C	15: 85,242,014	I484T	probably damaging	Het
Greb1l	T	A	18: 10,542,004	D1250E	possibly damaging	Het
Ift88	A	C	14: 57,438,245	K72Q	probably benign	Het
Impg1	T	A	9: 80,394,192	I228F	probably benign	Het
Itsn2	A	G	12: 4,658,091	N799S	possibly damaging	Het
Jade1	T	A	3: 41,609,857	C521S	probably benign	Het
Katna1	T	G	10: 7,761,276	L397R	probably damaging	Het
Kcnj15	A	C	16: 95,296,270	K250N	probably damaging	Het
Lrrc6	A	T	15: 66,449,630	S221T	probably benign	Het
Macc1	A	G	12: 119,446,206	I236M	possibly damaging	Het
Mapk13	C	T	17: 28,777,786	R276C	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mindy4	C	T	6: 55,301,087	H639Y	possibly damaging	Het
Mphosph9	A	G	5: 124,298,650	S544P	probably benign	Het
Muc4	T	C	16: 32,762,536	Y492H		Het
Mybbp1a	C	T	11: 72,443,594	T225I	probably benign	Het
Myo6	A	T	9: 80,251,804	K285I	unknown	Het
Nmd3	G	A	3: 69,739,995	V277I	probably benign	Het
Nol9	G	C	4: 152,039,461	R36P	probably damaging	Het
Nom1	A	G	5: 29,434,714	R13G	possibly damaging	Het
Nudt14	G	A	12: 112,939,286	H40Y	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr1474	A	T	19: 13,471,357	H87L	possibly damaging	Het
Olfr933	T	A	9: 38,976,391	F238L	probably benign	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pgghg	A	G	7: 140,944,666	I309V	probably benign	Het
Phf12	C	T	11: 78,023,684	P651S	possibly damaging	Het
Pltp	A	G	2: 164,852,490	L199P	probably damaging	Het
Pole	T	A	5: 110,289,809	L78I	probably benign	Het
Ppm1d	C	A	11: 85,337,135	H292Q	probably damaging	Het
Ppp2cb	A	C	8: 33,615,759	I224L	probably benign	Het
Rabggta	A	T	14: 55,720,423	I171N	probably damaging	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rb1cc1	G	A	1: 6,249,266	E970K	probably benign	Het
Rnh1	A	T	7: 141,168,631	V11D	probably benign	Het
Robo4	C	T	9: 37,404,224	T288I	probably benign	Het
Scmh1	A	G	4: 120,505,317	D250G	probably benign	Het
Sele	T	A	1: 164,053,679	C483S	probably damaging	Het
Slc12a6	A	G	2: 112,344,240		probably benign	Het
Slc5a4a	A	G	10: 76,166,712	E234G	possibly damaging	Het
Smarca5	A	G	8: 80,704,726	L954P	probably damaging	Het
St7	T	A	6: 17,906,495	N413K	probably damaging	Het
Stam2	C	T	2: 52,716,451	V141I	probably benign	Het
Strap	A	G	6: 137,739,813	N130S	probably benign	Het
Stxbp2	A	G	8: 3,642,627		probably benign	Het
Sult3a2	T	A	10: 33,779,693	I97F	probably benign	Het
Tbc1d32	A	T	10: 56,072,597	N965K	probably benign	Het
Tle3	T	A	9: 61,412,468	I506N	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tvp23a	A	G	16: 10,446,982	S22P	probably damaging	Het
Vmn2r82	A	G	10: 79,396,705	N846S	probably damaging	Het
Vmn2r83	A	G	10: 79,480,186	N472S	probably damaging	Het
Xpo7	G	A	14: 70,707,424	Q10*	probably null	Het
Zfp423	G	C	8: 87,781,753	S654R	probably benign	Het
Zfp646	A	T	7: 127,879,071	H140L	probably benign	Het
Zfp719	C	A	7: 43,584,065		probably benign	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TCTTGGTAAATACTCCCTGTTAGG -3'
(R):5'- CATTGAGACCCAGGATTCAGC -3'

Sequencing Primer
(F):5'- AATTCCCAGCACCTGTATGGGAG -3'
(R):5'- GGATTCAGCCTAGCCACTC -3'

Posted On

2021-10-11