Incidental Mutation 'R9018:Stim1'
ID 686128
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 102411275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 175 (T175I)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
AA Change: T175I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: T175I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
AA Change: T175I

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: T175I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,289,540 K1236N probably benign Het
Abca14 A G 7: 120,319,309 E1552G probably damaging Het
Adam3 A T 8: 24,694,276 Y569* probably null Het
Adgrb2 A G 4: 130,013,866 T998A probably benign Het
Adgre4 T A 17: 55,791,993 H166Q probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Ankrd11 A G 8: 122,895,512 S534P probably damaging Het
Bsn T C 9: 108,117,289 T596A probably benign Het
Cacnb4 C T 2: 52,434,694 R452Q probably benign Het
Cdc123 C A 2: 5,844,872 A13S probably benign Het
Chd7 G A 4: 8,847,083 G1609S possibly damaging Het
Cp T A 3: 19,989,152 C1035S probably damaging Het
Dcaf1 T A 9: 106,865,637 C1383S probably damaging Het
Derl3 G A 10: 75,893,770 V54I probably benign Het
Dgcr6 T C 16: 18,066,743 L25P probably damaging Het
Dmrt2 A G 19: 25,673,621 E57G probably benign Het
Dst A G 1: 34,196,059 K3562E probably damaging Het
Dyrk2 T C 10: 118,860,109 T415A probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbln1 T C 15: 85,242,014 I484T probably damaging Het
Greb1l T A 18: 10,542,004 D1250E possibly damaging Het
Ift88 A C 14: 57,438,245 K72Q probably benign Het
Impg1 T A 9: 80,394,192 I228F probably benign Het
Itsn2 A G 12: 4,658,091 N799S possibly damaging Het
Jade1 T A 3: 41,609,857 C521S probably benign Het
Katna1 T G 10: 7,761,276 L397R probably damaging Het
Kcnj15 A C 16: 95,296,270 K250N probably damaging Het
Lrrc6 A T 15: 66,449,630 S221T probably benign Het
Macc1 A G 12: 119,446,206 I236M possibly damaging Het
Mapk13 C T 17: 28,777,786 R276C probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mindy4 C T 6: 55,301,087 H639Y possibly damaging Het
Mphosph9 A G 5: 124,298,650 S544P probably benign Het
Muc4 T C 16: 32,762,536 Y492H Het
Mybbp1a C T 11: 72,443,594 T225I probably benign Het
Myo6 A T 9: 80,251,804 K285I unknown Het
Nmd3 G A 3: 69,739,995 V277I probably benign Het
Nom1 A G 5: 29,434,714 R13G possibly damaging Het
Nudt14 G A 12: 112,939,286 H40Y probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1474 A T 19: 13,471,357 H87L possibly damaging Het
Olfr933 T A 9: 38,976,391 F238L probably benign Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pgghg A G 7: 140,944,666 I309V probably benign Het
Phf12 C T 11: 78,023,684 P651S possibly damaging Het
Pltp A G 2: 164,852,490 L199P probably damaging Het
Pole T A 5: 110,289,809 L78I probably benign Het
Ppm1d C A 11: 85,337,135 H292Q probably damaging Het
Ppp2cb A C 8: 33,615,759 I224L probably benign Het
Rabggta A T 14: 55,720,423 I171N probably damaging Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rb1cc1 G A 1: 6,249,266 E970K probably benign Het
Rnh1 A T 7: 141,168,631 V11D probably benign Het
Scmh1 A G 4: 120,505,317 D250G probably benign Het
Sele T A 1: 164,053,679 C483S probably damaging Het
Slc5a4a A G 10: 76,166,712 E234G possibly damaging Het
Smarca5 A G 8: 80,704,726 L954P probably damaging Het
St7 T A 6: 17,906,495 N413K probably damaging Het
Stam2 C T 2: 52,716,451 V141I probably benign Het
Strap A G 6: 137,739,813 N130S probably benign Het
Sult3a2 T A 10: 33,779,693 I97F probably benign Het
Tbc1d32 A T 10: 56,072,597 N965K probably benign Het
Tle3 T A 9: 61,412,468 I506N probably damaging Het
Tvp23a A G 16: 10,446,982 S22P probably damaging Het
Vmn2r82 A G 10: 79,396,705 N846S probably damaging Het
Vmn2r83 A G 10: 79,480,186 N472S probably damaging Het
Xpo7 G A 14: 70,707,424 Q10* probably null Het
Zfp423 G C 8: 87,781,753 S654R probably benign Het
Zfp646 A T 7: 127,879,071 H140L probably benign Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TCTTGGTAAATACTCCCTGTTAGG -3'
(R):5'- CATTGAGACCCAGGATTCAGC -3'

Sequencing Primer
(F):5'- AATTCCCAGCACCTGTATGGGAG -3'
(R):5'- GGATTCAGCCTAGCCACTC -3'
Posted On 2021-10-11