Incidental Mutation 'R9018:Smarca5'
ID 686137
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D330027N15Rik, 4933427E24Rik, D030040M08Rik, Snf2h, MommeD4
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 194.009
Status Validated
Chromosome 8
Chromosomal Location 81426572-81466088 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81431355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 954 (L954P)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: L954P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: L954P

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.9548 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Greb1l T A 18: 10,542,004 (GRCm39) D1250E possibly damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mapk13 C T 17: 28,996,760 (GRCm39) R276C probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5b118 A T 19: 13,448,721 (GRCm39) H87L possibly damaging Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Pole T A 5: 110,437,675 (GRCm39) L78I probably benign Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Stim1 C T 7: 102,060,482 (GRCm39) T175I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 81,440,670 (GRCm39) missense probably benign 0.10
IGL01138:Smarca5 APN 8 81,427,705 (GRCm39) missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 81,454,277 (GRCm39) missense probably benign
IGL02338:Smarca5 APN 8 81,446,199 (GRCm39) splice site probably benign
IGL03212:Smarca5 APN 8 81,438,410 (GRCm39) missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 81,446,287 (GRCm39) missense probably damaging 1.00
Cipher UTSW 8 81,446,281 (GRCm39) missense probably damaging 1.00
Codebook UTSW 8 81,460,336 (GRCm39) missense probably benign
Codex UTSW 8 81,437,192 (GRCm39) missense probably damaging 0.99
Encryption UTSW 8 81,431,355 (GRCm39) missense probably damaging 1.00
Enigma UTSW 8 81,431,961 (GRCm39) missense probably benign 0.35
Key UTSW 8 81,452,680 (GRCm39) missense probably damaging 1.00
Sailor UTSW 8 81,463,355 (GRCm39) missense probably benign 0.07
Soldier UTSW 8 81,446,344 (GRCm39) missense probably damaging 1.00
tinker UTSW 8 81,460,379 (GRCm39) missense probably benign
R0254:Smarca5 UTSW 8 81,431,329 (GRCm39) missense probably benign 0.05
R0374:Smarca5 UTSW 8 81,463,360 (GRCm39) missense probably benign 0.30
R0625:Smarca5 UTSW 8 81,447,315 (GRCm39) critical splice donor site probably null
R1065:Smarca5 UTSW 8 81,431,343 (GRCm39) missense probably damaging 1.00
R1164:Smarca5 UTSW 8 81,437,260 (GRCm39) missense probably damaging 1.00
R1709:Smarca5 UTSW 8 81,435,849 (GRCm39) nonsense probably null
R2102:Smarca5 UTSW 8 81,431,304 (GRCm39) missense probably damaging 1.00
R3831:Smarca5 UTSW 8 81,455,123 (GRCm39) missense probably damaging 0.99
R4625:Smarca5 UTSW 8 81,437,192 (GRCm39) missense probably damaging 0.99
R4750:Smarca5 UTSW 8 81,460,336 (GRCm39) missense probably benign
R4822:Smarca5 UTSW 8 81,435,309 (GRCm39) splice site probably null
R4889:Smarca5 UTSW 8 81,431,326 (GRCm39) missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 81,437,233 (GRCm39) missense probably benign
R6120:Smarca5 UTSW 8 81,438,372 (GRCm39) missense probably damaging 0.98
R6582:Smarca5 UTSW 8 81,446,281 (GRCm39) missense probably damaging 1.00
R6939:Smarca5 UTSW 8 81,431,949 (GRCm39) missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 81,431,380 (GRCm39) missense probably damaging 1.00
R6973:Smarca5 UTSW 8 81,431,380 (GRCm39) missense probably damaging 1.00
R7027:Smarca5 UTSW 8 81,463,355 (GRCm39) missense probably benign 0.07
R7376:Smarca5 UTSW 8 81,452,680 (GRCm39) missense probably damaging 1.00
R7514:Smarca5 UTSW 8 81,444,163 (GRCm39) missense probably damaging 1.00
R7962:Smarca5 UTSW 8 81,463,388 (GRCm39) missense probably benign
R8031:Smarca5 UTSW 8 81,431,311 (GRCm39) missense probably damaging 1.00
R8400:Smarca5 UTSW 8 81,435,756 (GRCm39) missense probably benign 0.02
R8798:Smarca5 UTSW 8 81,443,137 (GRCm39) missense probably damaging 1.00
R8817:Smarca5 UTSW 8 81,460,379 (GRCm39) missense probably benign
R8824:Smarca5 UTSW 8 81,431,961 (GRCm39) missense probably benign 0.35
R8905:Smarca5 UTSW 8 81,440,577 (GRCm39) missense probably benign 0.14
R9028:Smarca5 UTSW 8 81,440,642 (GRCm39) missense probably damaging 1.00
R9203:Smarca5 UTSW 8 81,431,258 (GRCm39) nonsense probably null
R9253:Smarca5 UTSW 8 81,446,344 (GRCm39) missense probably damaging 1.00
R9294:Smarca5 UTSW 8 81,446,432 (GRCm39) missense probably damaging 1.00
R9328:Smarca5 UTSW 8 81,447,378 (GRCm39) missense probably benign 0.00
R9396:Smarca5 UTSW 8 81,463,358 (GRCm39) missense probably benign 0.00
R9514:Smarca5 UTSW 8 81,428,840 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACTGTGGCTGTGGATAG -3'
(R):5'- CAAAGAGCAGGTACGAATCTTG -3'

Sequencing Primer
(F):5'- CTCTGAAACTGAAGGAAAGTGTTC -3'
(R):5'- ACATTTATGGTTAGTTATGGAAAGGC -3'
Posted On 2021-10-11