Mutagenetix > Incidental Mutation

Incidental Mutation 'R9018:Smarca5'

686137

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9018 (G1)

Quality Score

194.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80704726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 954 (L954P)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: L954P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: L954P

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.9548

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,289,540	K1236N	probably benign	Het
Abca14	A	G	7: 120,319,309	E1552G	probably damaging	Het
Adam3	A	T	8: 24,694,276	Y569*	probably null	Het
Adgrb2	A	G	4: 130,013,866	T998A	probably benign	Het
Adgre4	T	A	17: 55,791,993	H166Q	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Ankrd11	A	G	8: 122,895,512	S534P	probably damaging	Het
Atn1	C	T	6: 124,745,698	E805K	unknown	Het
Bsn	T	C	9: 108,117,289	T596A	probably benign	Het
Cacnb4	C	T	2: 52,434,694	R452Q	probably benign	Het
Cdc123	C	A	2: 5,844,872	A13S	probably benign	Het
Chd7	G	A	4: 8,847,083	G1609S	possibly damaging	Het
Cp	T	A	3: 19,989,152	C1035S	probably damaging	Het
Dcaf1	T	A	9: 106,865,637	C1383S	probably damaging	Het
Derl3	G	A	10: 75,893,770	V54I	probably benign	Het
Dgcr6	T	C	16: 18,066,743	L25P	probably damaging	Het
Dmrt2	A	G	19: 25,673,621	E57G	probably benign	Het
Dst	A	G	1: 34,196,059	K3562E	probably damaging	Het
Dyrk2	T	C	10: 118,860,109	T415A	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbln1	T	C	15: 85,242,014	I484T	probably damaging	Het
Greb1l	T	A	18: 10,542,004	D1250E	possibly damaging	Het
Ift88	A	C	14: 57,438,245	K72Q	probably benign	Het
Impg1	T	A	9: 80,394,192	I228F	probably benign	Het
Itsn2	A	G	12: 4,658,091	N799S	possibly damaging	Het
Jade1	T	A	3: 41,609,857	C521S	probably benign	Het
Katna1	T	G	10: 7,761,276	L397R	probably damaging	Het
Kcnj15	A	C	16: 95,296,270	K250N	probably damaging	Het
Lrrc6	A	T	15: 66,449,630	S221T	probably benign	Het
Macc1	A	G	12: 119,446,206	I236M	possibly damaging	Het
Mapk13	C	T	17: 28,777,786	R276C	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mindy4	C	T	6: 55,301,087	H639Y	possibly damaging	Het
Mphosph9	A	G	5: 124,298,650	S544P	probably benign	Het
Muc4	T	C	16: 32,762,536	Y492H		Het
Mybbp1a	C	T	11: 72,443,594	T225I	probably benign	Het
Myo6	A	T	9: 80,251,804	K285I	unknown	Het
Nmd3	G	A	3: 69,739,995	V277I	probably benign	Het
Nol9	G	C	4: 152,039,461	R36P	probably damaging	Het
Nom1	A	G	5: 29,434,714	R13G	possibly damaging	Het
Nudt14	G	A	12: 112,939,286	H40Y	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr1474	A	T	19: 13,471,357	H87L	possibly damaging	Het
Olfr933	T	A	9: 38,976,391	F238L	probably benign	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pgghg	A	G	7: 140,944,666	I309V	probably benign	Het
Phf12	C	T	11: 78,023,684	P651S	possibly damaging	Het
Pltp	A	G	2: 164,852,490	L199P	probably damaging	Het
Pole	T	A	5: 110,289,809	L78I	probably benign	Het
Ppm1d	C	A	11: 85,337,135	H292Q	probably damaging	Het
Ppp2cb	A	C	8: 33,615,759	I224L	probably benign	Het
Rabggta	A	T	14: 55,720,423	I171N	probably damaging	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rb1cc1	G	A	1: 6,249,266	E970K	probably benign	Het
Rnh1	A	T	7: 141,168,631	V11D	probably benign	Het
Robo4	C	T	9: 37,404,224	T288I	probably benign	Het
Scmh1	A	G	4: 120,505,317	D250G	probably benign	Het
Sele	T	A	1: 164,053,679	C483S	probably damaging	Het
Slc12a6	A	G	2: 112,344,240		probably benign	Het
Slc5a4a	A	G	10: 76,166,712	E234G	possibly damaging	Het
St7	T	A	6: 17,906,495	N413K	probably damaging	Het
Stam2	C	T	2: 52,716,451	V141I	probably benign	Het
Stim1	C	T	7: 102,411,275	T175I	probably benign	Het
Strap	A	G	6: 137,739,813	N130S	probably benign	Het
Stxbp2	A	G	8: 3,642,627		probably benign	Het
Sult3a2	T	A	10: 33,779,693	I97F	probably benign	Het
Tbc1d32	A	T	10: 56,072,597	N965K	probably benign	Het
Tle3	T	A	9: 61,412,468	I506N	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tvp23a	A	G	16: 10,446,982	S22P	probably damaging	Het
Vmn2r82	A	G	10: 79,396,705	N846S	probably damaging	Het
Vmn2r83	A	G	10: 79,480,186	N472S	probably damaging	Het
Xpo7	G	A	14: 70,707,424	Q10*	probably null	Het
Zfp423	G	C	8: 87,781,753	S654R	probably benign	Het
Zfp646	A	T	7: 127,879,071	H140L	probably benign	Het
Zfp719	C	A	7: 43,584,065		probably benign	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAACTGTGGCTGTGGATAG -3'
(R):5'- CAAAGAGCAGGTACGAATCTTG -3'

Sequencing Primer
(F):5'- CTCTGAAACTGAAGGAAAGTGTTC -3'
(R):5'- ACATTTATGGTTAGTTATGGAAAGGC -3'

Posted On

2021-10-11