Incidental Mutation 'R9018:Smarca5'
ID 686137
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 194.009
Status Validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80704726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 954 (L954P)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: L954P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: L954P

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.9548 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,289,540 K1236N probably benign Het
Abca14 A G 7: 120,319,309 E1552G probably damaging Het
Adam3 A T 8: 24,694,276 Y569* probably null Het
Adgrb2 A G 4: 130,013,866 T998A probably benign Het
Adgre4 T A 17: 55,791,993 H166Q probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Ankrd11 A G 8: 122,895,512 S534P probably damaging Het
Atn1 C T 6: 124,745,698 E805K unknown Het
Bsn T C 9: 108,117,289 T596A probably benign Het
Cacnb4 C T 2: 52,434,694 R452Q probably benign Het
Cdc123 C A 2: 5,844,872 A13S probably benign Het
Chd7 G A 4: 8,847,083 G1609S possibly damaging Het
Cp T A 3: 19,989,152 C1035S probably damaging Het
Dcaf1 T A 9: 106,865,637 C1383S probably damaging Het
Derl3 G A 10: 75,893,770 V54I probably benign Het
Dgcr6 T C 16: 18,066,743 L25P probably damaging Het
Dmrt2 A G 19: 25,673,621 E57G probably benign Het
Dst A G 1: 34,196,059 K3562E probably damaging Het
Dyrk2 T C 10: 118,860,109 T415A probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbln1 T C 15: 85,242,014 I484T probably damaging Het
Greb1l T A 18: 10,542,004 D1250E possibly damaging Het
Ift88 A C 14: 57,438,245 K72Q probably benign Het
Impg1 T A 9: 80,394,192 I228F probably benign Het
Itsn2 A G 12: 4,658,091 N799S possibly damaging Het
Jade1 T A 3: 41,609,857 C521S probably benign Het
Katna1 T G 10: 7,761,276 L397R probably damaging Het
Kcnj15 A C 16: 95,296,270 K250N probably damaging Het
Lrrc6 A T 15: 66,449,630 S221T probably benign Het
Macc1 A G 12: 119,446,206 I236M possibly damaging Het
Mapk13 C T 17: 28,777,786 R276C probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mindy4 C T 6: 55,301,087 H639Y possibly damaging Het
Mphosph9 A G 5: 124,298,650 S544P probably benign Het
Muc4 T C 16: 32,762,536 Y492H Het
Mybbp1a C T 11: 72,443,594 T225I probably benign Het
Myo6 A T 9: 80,251,804 K285I unknown Het
Nmd3 G A 3: 69,739,995 V277I probably benign Het
Nol9 G C 4: 152,039,461 R36P probably damaging Het
Nom1 A G 5: 29,434,714 R13G possibly damaging Het
Nudt14 G A 12: 112,939,286 H40Y probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1474 A T 19: 13,471,357 H87L possibly damaging Het
Olfr933 T A 9: 38,976,391 F238L probably benign Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pgghg A G 7: 140,944,666 I309V probably benign Het
Phf12 C T 11: 78,023,684 P651S possibly damaging Het
Pltp A G 2: 164,852,490 L199P probably damaging Het
Pole T A 5: 110,289,809 L78I probably benign Het
Ppm1d C A 11: 85,337,135 H292Q probably damaging Het
Ppp2cb A C 8: 33,615,759 I224L probably benign Het
Rabggta A T 14: 55,720,423 I171N probably damaging Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rb1cc1 G A 1: 6,249,266 E970K probably benign Het
Rnh1 A T 7: 141,168,631 V11D probably benign Het
Robo4 C T 9: 37,404,224 T288I probably benign Het
Scmh1 A G 4: 120,505,317 D250G probably benign Het
Sele T A 1: 164,053,679 C483S probably damaging Het
Slc12a6 A G 2: 112,344,240 probably benign Het
Slc5a4a A G 10: 76,166,712 E234G possibly damaging Het
St7 T A 6: 17,906,495 N413K probably damaging Het
Stam2 C T 2: 52,716,451 V141I probably benign Het
Stim1 C T 7: 102,411,275 T175I probably benign Het
Strap A G 6: 137,739,813 N130S probably benign Het
Stxbp2 A G 8: 3,642,627 probably benign Het
Sult3a2 T A 10: 33,779,693 I97F probably benign Het
Tbc1d32 A T 10: 56,072,597 N965K probably benign Het
Tle3 T A 9: 61,412,468 I506N probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tvp23a A G 16: 10,446,982 S22P probably damaging Het
Vmn2r82 A G 10: 79,396,705 N846S probably damaging Het
Vmn2r83 A G 10: 79,480,186 N472S probably damaging Het
Xpo7 G A 14: 70,707,424 Q10* probably null Het
Zfp423 G C 8: 87,781,753 S654R probably benign Het
Zfp646 A T 7: 127,879,071 H140L probably benign Het
Zfp719 C A 7: 43,584,065 probably benign Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Encryption UTSW 8 80704726 missense probably damaging 1.00
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
Sailor UTSW 8 80736726 missense probably benign 0.07
Soldier UTSW 8 80719715 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9028:Smarca5 UTSW 8 80714013 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
R9514:Smarca5 UTSW 8 80702211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACTGTGGCTGTGGATAG -3'
(R):5'- CAAAGAGCAGGTACGAATCTTG -3'

Sequencing Primer
(F):5'- CTCTGAAACTGAAGGAAAGTGTTC -3'
(R):5'- ACATTTATGGTTAGTTATGGAAAGGC -3'
Posted On 2021-10-11