Incidental Mutation 'R9018:Tbc1d32'
ID 686148
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene Name TBC1 domain family, member 32
Synonyms D630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 56014293-56228689 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56072597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 965 (N965K)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
AlphaFold Q3URV1
Predicted Effect probably benign
Transcript: ENSMUST00000099739
AA Change: N965K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: N965K

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,289,540 K1236N probably benign Het
Abca14 A G 7: 120,319,309 E1552G probably damaging Het
Adam3 A T 8: 24,694,276 Y569* probably null Het
Adgrb2 A G 4: 130,013,866 T998A probably benign Het
Adgre4 T A 17: 55,791,993 H166Q probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Ankrd11 A G 8: 122,895,512 S534P probably damaging Het
Atn1 C T 6: 124,745,698 E805K unknown Het
Bsn T C 9: 108,117,289 T596A probably benign Het
Cacnb4 C T 2: 52,434,694 R452Q probably benign Het
Cdc123 C A 2: 5,844,872 A13S probably benign Het
Chd7 G A 4: 8,847,083 G1609S possibly damaging Het
Cp T A 3: 19,989,152 C1035S probably damaging Het
Dcaf1 T A 9: 106,865,637 C1383S probably damaging Het
Derl3 G A 10: 75,893,770 V54I probably benign Het
Dgcr6 T C 16: 18,066,743 L25P probably damaging Het
Dmrt2 A G 19: 25,673,621 E57G probably benign Het
Dst A G 1: 34,196,059 K3562E probably damaging Het
Dyrk2 T C 10: 118,860,109 T415A probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbln1 T C 15: 85,242,014 I484T probably damaging Het
Greb1l T A 18: 10,542,004 D1250E possibly damaging Het
Ift88 A C 14: 57,438,245 K72Q probably benign Het
Impg1 T A 9: 80,394,192 I228F probably benign Het
Itsn2 A G 12: 4,658,091 N799S possibly damaging Het
Jade1 T A 3: 41,609,857 C521S probably benign Het
Katna1 T G 10: 7,761,276 L397R probably damaging Het
Kcnj15 A C 16: 95,296,270 K250N probably damaging Het
Lrrc6 A T 15: 66,449,630 S221T probably benign Het
Macc1 A G 12: 119,446,206 I236M possibly damaging Het
Mapk13 C T 17: 28,777,786 R276C probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mindy4 C T 6: 55,301,087 H639Y possibly damaging Het
Mphosph9 A G 5: 124,298,650 S544P probably benign Het
Muc4 T C 16: 32,762,536 Y492H Het
Mybbp1a C T 11: 72,443,594 T225I probably benign Het
Myo6 A T 9: 80,251,804 K285I unknown Het
Nmd3 G A 3: 69,739,995 V277I probably benign Het
Nol9 G C 4: 152,039,461 R36P probably damaging Het
Nom1 A G 5: 29,434,714 R13G possibly damaging Het
Nudt14 G A 12: 112,939,286 H40Y probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1474 A T 19: 13,471,357 H87L possibly damaging Het
Olfr933 T A 9: 38,976,391 F238L probably benign Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pgghg A G 7: 140,944,666 I309V probably benign Het
Phf12 C T 11: 78,023,684 P651S possibly damaging Het
Pltp A G 2: 164,852,490 L199P probably damaging Het
Pole T A 5: 110,289,809 L78I probably benign Het
Ppm1d C A 11: 85,337,135 H292Q probably damaging Het
Ppp2cb A C 8: 33,615,759 I224L probably benign Het
Rabggta A T 14: 55,720,423 I171N probably damaging Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rb1cc1 G A 1: 6,249,266 E970K probably benign Het
Rnh1 A T 7: 141,168,631 V11D probably benign Het
Robo4 C T 9: 37,404,224 T288I probably benign Het
Scmh1 A G 4: 120,505,317 D250G probably benign Het
Sele T A 1: 164,053,679 C483S probably damaging Het
Slc12a6 A G 2: 112,344,240 probably benign Het
Slc5a4a A G 10: 76,166,712 E234G possibly damaging Het
Smarca5 A G 8: 80,704,726 L954P probably damaging Het
St7 T A 6: 17,906,495 N413K probably damaging Het
Stam2 C T 2: 52,716,451 V141I probably benign Het
Stim1 C T 7: 102,411,275 T175I probably benign Het
Strap A G 6: 137,739,813 N130S probably benign Het
Stxbp2 A G 8: 3,642,627 probably benign Het
Sult3a2 T A 10: 33,779,693 I97F probably benign Het
Tle3 T A 9: 61,412,468 I506N probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tvp23a A G 16: 10,446,982 S22P probably damaging Het
Vmn2r82 A G 10: 79,396,705 N846S probably damaging Het
Vmn2r83 A G 10: 79,480,186 N472S probably damaging Het
Xpo7 G A 14: 70,707,424 Q10* probably null Het
Zfp423 G C 8: 87,781,753 S654R probably benign Het
Zfp646 A T 7: 127,879,071 H140L probably benign Het
Zfp719 C A 7: 43,584,065 probably benign Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 56028077 missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56196592 missense possibly damaging 0.93
R8864:Tbc1d32 UTSW 10 56087559 missense probably benign 0.01
R9030:Tbc1d32 UTSW 10 56161145 missense possibly damaging 0.92
R9530:Tbc1d32 UTSW 10 56196411 missense probably damaging 0.98
R9616:Tbc1d32 UTSW 10 56161150 missense possibly damaging 0.85
Z1188:Tbc1d32 UTSW 10 56170881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTAATGATTTTATGCAGGGACAC -3'
(R):5'- ATGCCCTGTCTAGCCATGTG -3'

Sequencing Primer
(F):5'- GGACACCCCCAGTATAGAACAACTC -3'
(R):5'- GCCATGTGCTATGCATGC -3'
Posted On 2021-10-11