Incidental Mutation 'R9018:Slc5a4a'
ID 686150
Institutional Source Beutler Lab
Gene Symbol Slc5a4a
Ensembl Gene ENSMUSG00000020229
Gene Name solute carrier family 5, member 4a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76147451-76189265 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76166712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000020450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020450]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000020450
AA Change: E234G

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020450
Gene: ENSMUSG00000020229
AA Change: E234G

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 4e-161 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 636 655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,289,540 K1236N probably benign Het
Abca14 A G 7: 120,319,309 E1552G probably damaging Het
Adam3 A T 8: 24,694,276 Y569* probably null Het
Adgrb2 A G 4: 130,013,866 T998A probably benign Het
Adgre4 T A 17: 55,791,993 H166Q probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Ankrd11 A G 8: 122,895,512 S534P probably damaging Het
Atn1 C T 6: 124,745,698 E805K unknown Het
Bsn T C 9: 108,117,289 T596A probably benign Het
Cacnb4 C T 2: 52,434,694 R452Q probably benign Het
Cdc123 C A 2: 5,844,872 A13S probably benign Het
Chd7 G A 4: 8,847,083 G1609S possibly damaging Het
Cp T A 3: 19,989,152 C1035S probably damaging Het
Dcaf1 T A 9: 106,865,637 C1383S probably damaging Het
Derl3 G A 10: 75,893,770 V54I probably benign Het
Dgcr6 T C 16: 18,066,743 L25P probably damaging Het
Dmrt2 A G 19: 25,673,621 E57G probably benign Het
Dst A G 1: 34,196,059 K3562E probably damaging Het
Dyrk2 T C 10: 118,860,109 T415A probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbln1 T C 15: 85,242,014 I484T probably damaging Het
Greb1l T A 18: 10,542,004 D1250E possibly damaging Het
Ift88 A C 14: 57,438,245 K72Q probably benign Het
Impg1 T A 9: 80,394,192 I228F probably benign Het
Itsn2 A G 12: 4,658,091 N799S possibly damaging Het
Jade1 T A 3: 41,609,857 C521S probably benign Het
Katna1 T G 10: 7,761,276 L397R probably damaging Het
Kcnj15 A C 16: 95,296,270 K250N probably damaging Het
Lrrc6 A T 15: 66,449,630 S221T probably benign Het
Macc1 A G 12: 119,446,206 I236M possibly damaging Het
Mapk13 C T 17: 28,777,786 R276C probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mindy4 C T 6: 55,301,087 H639Y possibly damaging Het
Mphosph9 A G 5: 124,298,650 S544P probably benign Het
Muc4 T C 16: 32,762,536 Y492H Het
Mybbp1a C T 11: 72,443,594 T225I probably benign Het
Myo6 A T 9: 80,251,804 K285I unknown Het
Nmd3 G A 3: 69,739,995 V277I probably benign Het
Nol9 G C 4: 152,039,461 R36P probably damaging Het
Nom1 A G 5: 29,434,714 R13G possibly damaging Het
Nudt14 G A 12: 112,939,286 H40Y probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1474 A T 19: 13,471,357 H87L possibly damaging Het
Olfr933 T A 9: 38,976,391 F238L probably benign Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pgghg A G 7: 140,944,666 I309V probably benign Het
Phf12 C T 11: 78,023,684 P651S possibly damaging Het
Pltp A G 2: 164,852,490 L199P probably damaging Het
Pole T A 5: 110,289,809 L78I probably benign Het
Ppm1d C A 11: 85,337,135 H292Q probably damaging Het
Ppp2cb A C 8: 33,615,759 I224L probably benign Het
Rabggta A T 14: 55,720,423 I171N probably damaging Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rb1cc1 G A 1: 6,249,266 E970K probably benign Het
Rnh1 A T 7: 141,168,631 V11D probably benign Het
Robo4 C T 9: 37,404,224 T288I probably benign Het
Scmh1 A G 4: 120,505,317 D250G probably benign Het
Sele T A 1: 164,053,679 C483S probably damaging Het
Slc12a6 A G 2: 112,344,240 probably benign Het
Smarca5 A G 8: 80,704,726 L954P probably damaging Het
St7 T A 6: 17,906,495 N413K probably damaging Het
Stam2 C T 2: 52,716,451 V141I probably benign Het
Stim1 C T 7: 102,411,275 T175I probably benign Het
Strap A G 6: 137,739,813 N130S probably benign Het
Stxbp2 A G 8: 3,642,627 probably benign Het
Sult3a2 T A 10: 33,779,693 I97F probably benign Het
Tbc1d32 A T 10: 56,072,597 N965K probably benign Het
Tle3 T A 9: 61,412,468 I506N probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tvp23a A G 16: 10,446,982 S22P probably damaging Het
Vmn2r82 A G 10: 79,396,705 N846S probably damaging Het
Vmn2r83 A G 10: 79,480,186 N472S probably damaging Het
Xpo7 G A 14: 70,707,424 Q10* probably null Het
Zfp423 G C 8: 87,781,753 S654R probably benign Het
Zfp646 A T 7: 127,879,071 H140L probably benign Het
Zfp719 C A 7: 43,584,065 probably benign Het
Other mutations in Slc5a4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Slc5a4a APN 10 76163733 missense probably damaging 1.00
IGL01725:Slc5a4a APN 10 76181674 missense probably benign 0.00
IGL02629:Slc5a4a APN 10 76147579 missense unknown
IGL02976:Slc5a4a APN 10 76170693 missense possibly damaging 0.67
IGL03255:Slc5a4a APN 10 76150512 missense probably damaging 1.00
IGL03258:Slc5a4a APN 10 76150552 missense possibly damaging 0.81
R0054:Slc5a4a UTSW 10 76178197 missense probably null 0.00
R0244:Slc5a4a UTSW 10 76189152 missense possibly damaging 0.46
R0398:Slc5a4a UTSW 10 76182722 missense possibly damaging 0.46
R0799:Slc5a4a UTSW 10 76176534 missense probably benign 0.00
R1160:Slc5a4a UTSW 10 76178161 missense possibly damaging 0.52
R1471:Slc5a4a UTSW 10 76186528 missense probably damaging 0.99
R1720:Slc5a4a UTSW 10 76189269 splice site probably null
R1857:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1858:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1859:Slc5a4a UTSW 10 76166735 missense probably benign 0.27
R1942:Slc5a4a UTSW 10 76147588 missense unknown
R2016:Slc5a4a UTSW 10 76153580 missense probably benign 0.00
R2316:Slc5a4a UTSW 10 76178081 splice site probably null
R3420:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3421:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3422:Slc5a4a UTSW 10 76176573 missense probably benign 0.00
R3845:Slc5a4a UTSW 10 76189149 missense probably damaging 0.99
R3874:Slc5a4a UTSW 10 76181655 missense probably benign 0.42
R4523:Slc5a4a UTSW 10 76148362 missense probably damaging 0.99
R4537:Slc5a4a UTSW 10 76178095 nonsense probably null
R4538:Slc5a4a UTSW 10 76178095 nonsense probably null
R4755:Slc5a4a UTSW 10 76186564 missense probably benign 0.00
R4868:Slc5a4a UTSW 10 76178231 missense probably damaging 0.98
R5135:Slc5a4a UTSW 10 76147594 missense unknown
R5254:Slc5a4a UTSW 10 76182738 nonsense probably null
R6083:Slc5a4a UTSW 10 76147597 missense unknown
R6331:Slc5a4a UTSW 10 76178200 missense probably damaging 0.98
R7591:Slc5a4a UTSW 10 76147667 critical splice donor site probably benign
R7671:Slc5a4a UTSW 10 76147550 missense unknown
R8785:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R8929:Slc5a4a UTSW 10 76170783 missense probably benign 0.27
R8993:Slc5a4a UTSW 10 76186535 missense probably benign 0.15
R9474:Slc5a4a UTSW 10 76150404 critical splice acceptor site probably benign
R9567:Slc5a4a UTSW 10 76186562 missense probably benign 0.08
R9648:Slc5a4a UTSW 10 76166774 missense probably damaging 1.00
Z1177:Slc5a4a UTSW 10 76166744 missense probably benign 0.01
Z1177:Slc5a4a UTSW 10 76182847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAATTTGACCTGTTGCCAGTG -3'
(R):5'- ACGCATGCGCACTTACTCAC -3'

Sequencing Primer
(F):5'- TGACCTGTTGCCAGTGGAGAC -3'
(R):5'- TGGTTTATGCACCAGTACCACAAAG -3'
Posted On 2021-10-11