Mutagenetix > Incidental Mutation

Incidental Mutation 'R9018:Ppm1d'

686158

Institutional Source

Beutler Lab

Gene Symbol

Ppm1d

Ensembl Gene

ENSMUSG00000020525

Gene Name

protein phosphatase 1D magnesium-dependent, delta isoform

Synonyms

Wip1

MMRRC Submission

068848-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85311244-85347066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85337135 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 292 (H292Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]

AlphaFold

Q9QZ67

Predicted Effect

probably damaging
Transcript: ENSMUST00000020835
AA Change: H292Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: H292Q

Domain	Start	End	E-Value	Type
PP2Cc	1	366	1.4e-76	SMART
PP2C_SIG	78	368	6.09e0	SMART
low complexity region	403	415	N/A	INTRINSIC
Blast:PP2Cc	416	476	1e-19	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525
AA Change: H147Q

Domain	Start	End	E-Value	Type
PP2Cc	1	170	2.87e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,289,540	K1236N	probably benign	Het
Abca14	A	G	7: 120,319,309	E1552G	probably damaging	Het
Adam3	A	T	8: 24,694,276	Y569*	probably null	Het
Adgrb2	A	G	4: 130,013,866	T998A	probably benign	Het
Adgre4	T	A	17: 55,791,993	H166Q	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Ankrd11	A	G	8: 122,895,512	S534P	probably damaging	Het
Atn1	C	T	6: 124,745,698	E805K	unknown	Het
Bsn	T	C	9: 108,117,289	T596A	probably benign	Het
Cacnb4	C	T	2: 52,434,694	R452Q	probably benign	Het
Cdc123	C	A	2: 5,844,872	A13S	probably benign	Het
Chd7	G	A	4: 8,847,083	G1609S	possibly damaging	Het
Cp	T	A	3: 19,989,152	C1035S	probably damaging	Het
Dcaf1	T	A	9: 106,865,637	C1383S	probably damaging	Het
Derl3	G	A	10: 75,893,770	V54I	probably benign	Het
Dgcr6	T	C	16: 18,066,743	L25P	probably damaging	Het
Dmrt2	A	G	19: 25,673,621	E57G	probably benign	Het
Dst	A	G	1: 34,196,059	K3562E	probably damaging	Het
Dyrk2	T	C	10: 118,860,109	T415A	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbln1	T	C	15: 85,242,014	I484T	probably damaging	Het
Greb1l	T	A	18: 10,542,004	D1250E	possibly damaging	Het
Ift88	A	C	14: 57,438,245	K72Q	probably benign	Het
Impg1	T	A	9: 80,394,192	I228F	probably benign	Het
Itsn2	A	G	12: 4,658,091	N799S	possibly damaging	Het
Jade1	T	A	3: 41,609,857	C521S	probably benign	Het
Katna1	T	G	10: 7,761,276	L397R	probably damaging	Het
Kcnj15	A	C	16: 95,296,270	K250N	probably damaging	Het
Lrrc6	A	T	15: 66,449,630	S221T	probably benign	Het
Macc1	A	G	12: 119,446,206	I236M	possibly damaging	Het
Mapk13	C	T	17: 28,777,786	R276C	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mindy4	C	T	6: 55,301,087	H639Y	possibly damaging	Het
Mphosph9	A	G	5: 124,298,650	S544P	probably benign	Het
Muc4	T	C	16: 32,762,536	Y492H		Het
Mybbp1a	C	T	11: 72,443,594	T225I	probably benign	Het
Myo6	A	T	9: 80,251,804	K285I	unknown	Het
Nmd3	G	A	3: 69,739,995	V277I	probably benign	Het
Nol9	G	C	4: 152,039,461	R36P	probably damaging	Het
Nom1	A	G	5: 29,434,714	R13G	possibly damaging	Het
Nudt14	G	A	12: 112,939,286	H40Y	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr1474	A	T	19: 13,471,357	H87L	possibly damaging	Het
Olfr933	T	A	9: 38,976,391	F238L	probably benign	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pgghg	A	G	7: 140,944,666	I309V	probably benign	Het
Phf12	C	T	11: 78,023,684	P651S	possibly damaging	Het
Pltp	A	G	2: 164,852,490	L199P	probably damaging	Het
Pole	T	A	5: 110,289,809	L78I	probably benign	Het
Ppp2cb	A	C	8: 33,615,759	I224L	probably benign	Het
Rabggta	A	T	14: 55,720,423	I171N	probably damaging	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rb1cc1	G	A	1: 6,249,266	E970K	probably benign	Het
Rnh1	A	T	7: 141,168,631	V11D	probably benign	Het
Robo4	C	T	9: 37,404,224	T288I	probably benign	Het
Scmh1	A	G	4: 120,505,317	D250G	probably benign	Het
Sele	T	A	1: 164,053,679	C483S	probably damaging	Het
Slc12a6	A	G	2: 112,344,240		probably benign	Het
Slc5a4a	A	G	10: 76,166,712	E234G	possibly damaging	Het
Smarca5	A	G	8: 80,704,726	L954P	probably damaging	Het
St7	T	A	6: 17,906,495	N413K	probably damaging	Het
Stam2	C	T	2: 52,716,451	V141I	probably benign	Het
Stim1	C	T	7: 102,411,275	T175I	probably benign	Het
Strap	A	G	6: 137,739,813	N130S	probably benign	Het
Stxbp2	A	G	8: 3,642,627		probably benign	Het
Sult3a2	T	A	10: 33,779,693	I97F	probably benign	Het
Tbc1d32	A	T	10: 56,072,597	N965K	probably benign	Het
Tle3	T	A	9: 61,412,468	I506N	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tvp23a	A	G	16: 10,446,982	S22P	probably damaging	Het
Vmn2r82	A	G	10: 79,396,705	N846S	probably damaging	Het
Vmn2r83	A	G	10: 79,480,186	N472S	probably damaging	Het
Xpo7	G	A	14: 70,707,424	Q10*	probably null	Het
Zfp423	G	C	8: 87,781,753	S654R	probably benign	Het
Zfp646	A	T	7: 127,879,071	H140L	probably benign	Het
Zfp719	C	A	7: 43,584,065		probably benign	Het

Other mutations in Ppm1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02095:Ppm1d	APN	11	85327006	missense	probably benign	0.04
IGL02351:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02358:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02496:Ppm1d	APN	11	85339666	missense	possibly damaging	0.51
IGL02667:Ppm1d	APN	11	85332285	missense	probably damaging	1.00
IGL02885:Ppm1d	APN	11	85326944	missense	possibly damaging	0.52
IGL03085:Ppm1d	APN	11	85337163	missense	probably null	0.80
R0114:Ppm1d	UTSW	11	85326905	missense	probably damaging	1.00
R0606:Ppm1d	UTSW	11	85345877	missense	probably benign	0.27
R1014:Ppm1d	UTSW	11	85337154	missense	probably damaging	0.98
R1548:Ppm1d	UTSW	11	85339605	missense	probably damaging	1.00
R3774:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R3775:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R4025:Ppm1d	UTSW	11	85345757	missense	probably benign	0.09
R4065:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4067:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4118:Ppm1d	UTSW	11	85311582	missense	probably benign	0.01
R5169:Ppm1d	UTSW	11	85332370	missense	probably damaging	1.00
R5384:Ppm1d	UTSW	11	85311783	missense	probably damaging	0.98
R5861:Ppm1d	UTSW	11	85311848	missense	possibly damaging	0.70
R5890:Ppm1d	UTSW	11	85326908	missense	probably damaging	1.00
R6394:Ppm1d	UTSW	11	85339672	missense	probably benign
R6992:Ppm1d	UTSW	11	85332352	missense	probably damaging	1.00
R7006:Ppm1d	UTSW	11	85337151	missense	possibly damaging	0.92
R7297:Ppm1d	UTSW	11	85345995	missense	probably damaging	1.00
R7993:Ppm1d	UTSW	11	85326951	missense	probably damaging	1.00
R8099:Ppm1d	UTSW	11	85339666	missense	possibly damaging	0.51
R8697:Ppm1d	UTSW	11	85337160	missense	possibly damaging	0.95
R8738:Ppm1d	UTSW	11	85345906	missense	probably damaging	0.99
R9188:Ppm1d	UTSW	11	85345921	missense	possibly damaging	0.93
Z1176:Ppm1d	UTSW	11	85339573	missense	probably benign	0.09
Z1177:Ppm1d	UTSW	11	85326963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGAGGGAATTCTCTTGTCCC -3'
(R):5'- CTAGACTCACAGCCATGGAC -3'

Sequencing Primer
(F):5'- CGAGGGAATTCTCTTGTCCCTAGTG -3'
(R):5'- TAGACTCACAGCCATGGACAACAAG -3'

Posted On

2021-10-11