Incidental Mutation 'R9018:Ppm1d'
ID 686158
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85337135 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 292 (H292Q)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]
AlphaFold Q9QZ67
Predicted Effect probably damaging
Transcript: ENSMUST00000020835
AA Change: H292Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: H292Q

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525
AA Change: H147Q

DomainStartEndE-ValueType
PP2Cc 1 170 2.87e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,289,540 K1236N probably benign Het
Abca14 A G 7: 120,319,309 E1552G probably damaging Het
Adam3 A T 8: 24,694,276 Y569* probably null Het
Adgrb2 A G 4: 130,013,866 T998A probably benign Het
Adgre4 T A 17: 55,791,993 H166Q probably benign Het
Ank1 G A 8: 23,116,248 G1219S probably null Het
Ankrd11 A G 8: 122,895,512 S534P probably damaging Het
Bsn T C 9: 108,117,289 T596A probably benign Het
Cacnb4 C T 2: 52,434,694 R452Q probably benign Het
Cdc123 C A 2: 5,844,872 A13S probably benign Het
Chd7 G A 4: 8,847,083 G1609S possibly damaging Het
Cp T A 3: 19,989,152 C1035S probably damaging Het
Dcaf1 T A 9: 106,865,637 C1383S probably damaging Het
Derl3 G A 10: 75,893,770 V54I probably benign Het
Dgcr6 T C 16: 18,066,743 L25P probably damaging Het
Dmrt2 A G 19: 25,673,621 E57G probably benign Het
Dst A G 1: 34,196,059 K3562E probably damaging Het
Dyrk2 T C 10: 118,860,109 T415A probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fbln1 T C 15: 85,242,014 I484T probably damaging Het
Greb1l T A 18: 10,542,004 D1250E possibly damaging Het
Ift88 A C 14: 57,438,245 K72Q probably benign Het
Impg1 T A 9: 80,394,192 I228F probably benign Het
Itsn2 A G 12: 4,658,091 N799S possibly damaging Het
Jade1 T A 3: 41,609,857 C521S probably benign Het
Katna1 T G 10: 7,761,276 L397R probably damaging Het
Kcnj15 A C 16: 95,296,270 K250N probably damaging Het
Lrrc6 A T 15: 66,449,630 S221T probably benign Het
Macc1 A G 12: 119,446,206 I236M possibly damaging Het
Mapk13 C T 17: 28,777,786 R276C probably benign Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Mindy4 C T 6: 55,301,087 H639Y possibly damaging Het
Mphosph9 A G 5: 124,298,650 S544P probably benign Het
Muc4 T C 16: 32,762,536 Y492H Het
Mybbp1a C T 11: 72,443,594 T225I probably benign Het
Myo6 A T 9: 80,251,804 K285I unknown Het
Nmd3 G A 3: 69,739,995 V277I probably benign Het
Nom1 A G 5: 29,434,714 R13G possibly damaging Het
Nudt14 G A 12: 112,939,286 H40Y probably damaging Het
Nxt2 C T X: 142,237,751 A118V possibly damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr1474 A T 19: 13,471,357 H87L possibly damaging Het
Olfr933 T A 9: 38,976,391 F238L probably benign Het
Pcnx4 T A 12: 72,556,663 F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pgghg A G 7: 140,944,666 I309V probably benign Het
Phf12 C T 11: 78,023,684 P651S possibly damaging Het
Pltp A G 2: 164,852,490 L199P probably damaging Het
Pole T A 5: 110,289,809 L78I probably benign Het
Ppp2cb A C 8: 33,615,759 I224L probably benign Het
Rabggta A T 14: 55,720,423 I171N probably damaging Het
Rapgef5 A G 12: 117,748,397 I740V probably damaging Het
Rb1cc1 G A 1: 6,249,266 E970K probably benign Het
Rnh1 A T 7: 141,168,631 V11D probably benign Het
Scmh1 A G 4: 120,505,317 D250G probably benign Het
Sele T A 1: 164,053,679 C483S probably damaging Het
Slc5a4a A G 10: 76,166,712 E234G possibly damaging Het
Smarca5 A G 8: 80,704,726 L954P probably damaging Het
St7 T A 6: 17,906,495 N413K probably damaging Het
Stam2 C T 2: 52,716,451 V141I probably benign Het
Stim1 C T 7: 102,411,275 T175I probably benign Het
Strap A G 6: 137,739,813 N130S probably benign Het
Sult3a2 T A 10: 33,779,693 I97F probably benign Het
Tbc1d32 A T 10: 56,072,597 N965K probably benign Het
Tle3 T A 9: 61,412,468 I506N probably damaging Het
Tvp23a A G 16: 10,446,982 S22P probably damaging Het
Vmn2r82 A G 10: 79,396,705 N846S probably damaging Het
Vmn2r83 A G 10: 79,480,186 N472S probably damaging Het
Xpo7 G A 14: 70,707,424 Q10* probably null Het
Zfp423 G C 8: 87,781,753 S654R probably benign Het
Zfp646 A T 7: 127,879,071 H140L probably benign Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGGGAATTCTCTTGTCCC -3'
(R):5'- CTAGACTCACAGCCATGGAC -3'

Sequencing Primer
(F):5'- CGAGGGAATTCTCTTGTCCCTAGTG -3'
(R):5'- TAGACTCACAGCCATGGACAACAAG -3'
Posted On 2021-10-11