Incidental Mutation 'R9018:Mapk13'
ID 686174
Institutional Source Beutler Lab
Gene Symbol Mapk13
Ensembl Gene ENSMUSG00000004864
Gene Name mitogen-activated protein kinase 13
Synonyms p38 delta MAP kinase, SAPK4, Serk4
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R9018 (G1)
Quality Score 169.009
Status Validated
Chromosome 17
Chromosomal Location 28988260-28997678 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 28996760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 276 (R276C)
Ref Sequence ENSEMBL: ENSMUSP00000004986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004986] [ENSMUST00000129096]
AlphaFold Q9Z1B7
Predicted Effect probably benign
Transcript: ENSMUST00000004986
AA Change: R276C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004986
Gene: ENSMUSG00000004864
AA Change: R276C

DomainStartEndE-ValueType
S_TKc 25 308 8.72e-97 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129096
AA Change: T225M

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115659
Gene: ENSMUSG00000004864
AA Change: T225M

DomainStartEndE-ValueType
Pfam:Pkinase 25 209 1.1e-49 PFAM
Pfam:Pkinase_Tyr 27 210 2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit improved glucose tolerance, increased insulin secretion, decreased blood glucose, and decreased susceptibility to diet- or chemically-induced diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Greb1l T A 18: 10,542,004 (GRCm39) D1250E possibly damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5b118 A T 19: 13,448,721 (GRCm39) H87L possibly damaging Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Pole T A 5: 110,437,675 (GRCm39) L78I probably benign Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
Smarca5 A G 8: 81,431,355 (GRCm39) L954P probably damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Stim1 C T 7: 102,060,482 (GRCm39) T175I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Mapk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Mapk13 APN 17 28,995,379 (GRCm39) missense probably damaging 1.00
IGL01918:Mapk13 APN 17 28,994,304 (GRCm39) missense probably damaging 1.00
IGL02265:Mapk13 APN 17 28,996,692 (GRCm39) splice site probably benign
IGL02451:Mapk13 APN 17 28,995,387 (GRCm39) missense probably damaging 1.00
IGL02977:Mapk13 APN 17 28,995,322 (GRCm39) missense probably damaging 1.00
IGL03118:Mapk13 APN 17 28,996,709 (GRCm39) missense probably benign 0.14
IGL03188:Mapk13 APN 17 28,995,557 (GRCm39) intron probably benign
R0501:Mapk13 UTSW 17 28,995,327 (GRCm39) missense probably damaging 1.00
R0538:Mapk13 UTSW 17 28,994,229 (GRCm39) missense probably damaging 1.00
R2240:Mapk13 UTSW 17 28,997,085 (GRCm39) missense probably damaging 0.98
R4368:Mapk13 UTSW 17 28,996,539 (GRCm39) splice site probably null
R4613:Mapk13 UTSW 17 28,988,426 (GRCm39) missense probably damaging 1.00
R4649:Mapk13 UTSW 17 28,997,461 (GRCm39) nonsense probably null
R4684:Mapk13 UTSW 17 28,989,023 (GRCm39) missense probably damaging 1.00
R4796:Mapk13 UTSW 17 28,994,528 (GRCm39) missense probably damaging 1.00
R4863:Mapk13 UTSW 17 28,995,284 (GRCm39) missense probably damaging 1.00
R4923:Mapk13 UTSW 17 28,997,197 (GRCm39) missense probably benign
R5220:Mapk13 UTSW 17 28,997,465 (GRCm39) missense probably benign 0.00
R5247:Mapk13 UTSW 17 28,996,725 (GRCm39) missense probably benign 0.01
R5370:Mapk13 UTSW 17 28,995,326 (GRCm39) nonsense probably null
R6838:Mapk13 UTSW 17 28,996,535 (GRCm39) splice site probably null
R6843:Mapk13 UTSW 17 28,994,427 (GRCm39) splice site probably null
R7187:Mapk13 UTSW 17 28,995,361 (GRCm39) missense probably damaging 1.00
R9227:Mapk13 UTSW 17 28,994,532 (GRCm39) missense probably damaging 1.00
R9230:Mapk13 UTSW 17 28,994,532 (GRCm39) missense probably damaging 1.00
R9241:Mapk13 UTSW 17 28,990,187 (GRCm39) missense probably damaging 0.99
R9249:Mapk13 UTSW 17 28,988,490 (GRCm39) missense probably damaging 1.00
R9274:Mapk13 UTSW 17 28,988,490 (GRCm39) missense probably damaging 1.00
R9777:Mapk13 UTSW 17 28,997,075 (GRCm39) missense probably damaging 1.00
Z1088:Mapk13 UTSW 17 28,996,507 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGACTGGCACCTTCTTATGGG -3'
(R):5'- CATCTTGTCGAGCAGGTCTG -3'

Sequencing Primer
(F):5'- GGCACCTTCTTATGGGCTCCC -3'
(R):5'- ACATGGTGAGCCTTGCAC -3'
Posted On 2021-10-11