Mutagenetix > Incidental Mutation

Incidental Mutation 'R9018:Greb1l'

686176

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9018 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10542004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1250 (D1250E)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048977
AA Change: D1250E

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D1250E

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (77/77)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	A	T	7: 120,289,540	K1236N	probably benign	Het
Abca14	A	G	7: 120,319,309	E1552G	probably damaging	Het
Adam3	A	T	8: 24,694,276	Y569*	probably null	Het
Adgrb2	A	G	4: 130,013,866	T998A	probably benign	Het
Adgre4	T	A	17: 55,791,993	H166Q	probably benign	Het
Ank1	G	A	8: 23,116,248	G1219S	probably null	Het
Ankrd11	A	G	8: 122,895,512	S534P	probably damaging	Het
Atn1	C	T	6: 124,745,698	E805K	unknown	Het
Bsn	T	C	9: 108,117,289	T596A	probably benign	Het
Cacnb4	C	T	2: 52,434,694	R452Q	probably benign	Het
Cdc123	C	A	2: 5,844,872	A13S	probably benign	Het
Chd7	G	A	4: 8,847,083	G1609S	possibly damaging	Het
Cp	T	A	3: 19,989,152	C1035S	probably damaging	Het
Dcaf1	T	A	9: 106,865,637	C1383S	probably damaging	Het
Derl3	G	A	10: 75,893,770	V54I	probably benign	Het
Dgcr6	T	C	16: 18,066,743	L25P	probably damaging	Het
Dmrt2	A	G	19: 25,673,621	E57G	probably benign	Het
Dst	A	G	1: 34,196,059	K3562E	probably damaging	Het
Dyrk2	T	C	10: 118,860,109	T415A	probably damaging	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fbln1	T	C	15: 85,242,014	I484T	probably damaging	Het
Ift88	A	C	14: 57,438,245	K72Q	probably benign	Het
Impg1	T	A	9: 80,394,192	I228F	probably benign	Het
Itsn2	A	G	12: 4,658,091	N799S	possibly damaging	Het
Jade1	T	A	3: 41,609,857	C521S	probably benign	Het
Katna1	T	G	10: 7,761,276	L397R	probably damaging	Het
Kcnj15	A	C	16: 95,296,270	K250N	probably damaging	Het
Lrrc6	A	T	15: 66,449,630	S221T	probably benign	Het
Macc1	A	G	12: 119,446,206	I236M	possibly damaging	Het
Mapk13	C	T	17: 28,777,786	R276C	probably benign	Het
Mier2	G	A	10: 79,548,440	R166W	probably damaging	Het
Mindy4	C	T	6: 55,301,087	H639Y	possibly damaging	Het
Mphosph9	A	G	5: 124,298,650	S544P	probably benign	Het
Muc4	T	C	16: 32,762,536	Y492H		Het
Mybbp1a	C	T	11: 72,443,594	T225I	probably benign	Het
Myo6	A	T	9: 80,251,804	K285I	unknown	Het
Nmd3	G	A	3: 69,739,995	V277I	probably benign	Het
Nol9	G	C	4: 152,039,461	R36P	probably damaging	Het
Nom1	A	G	5: 29,434,714	R13G	possibly damaging	Het
Nudt14	G	A	12: 112,939,286	H40Y	probably damaging	Het
Nxt2	C	T	X: 142,237,751	A118V	possibly damaging	Het
Olfr1375	G	A	11: 51,048,111	M1I	probably null	Het
Olfr1474	A	T	19: 13,471,357	H87L	possibly damaging	Het
Olfr933	T	A	9: 38,976,391	F238L	probably benign	Het
Pcnx4	T	A	12: 72,556,663	F492I	probably damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pgghg	A	G	7: 140,944,666	I309V	probably benign	Het
Phf12	C	T	11: 78,023,684	P651S	possibly damaging	Het
Pltp	A	G	2: 164,852,490	L199P	probably damaging	Het
Pole	T	A	5: 110,289,809	L78I	probably benign	Het
Ppm1d	C	A	11: 85,337,135	H292Q	probably damaging	Het
Ppp2cb	A	C	8: 33,615,759	I224L	probably benign	Het
Rabggta	A	T	14: 55,720,423	I171N	probably damaging	Het
Rapgef5	A	G	12: 117,748,397	I740V	probably damaging	Het
Rb1cc1	G	A	1: 6,249,266	E970K	probably benign	Het
Rnh1	A	T	7: 141,168,631	V11D	probably benign	Het
Robo4	C	T	9: 37,404,224	T288I	probably benign	Het
Scmh1	A	G	4: 120,505,317	D250G	probably benign	Het
Sele	T	A	1: 164,053,679	C483S	probably damaging	Het
Slc12a6	A	G	2: 112,344,240		probably benign	Het
Slc5a4a	A	G	10: 76,166,712	E234G	possibly damaging	Het
Smarca5	A	G	8: 80,704,726	L954P	probably damaging	Het
St7	T	A	6: 17,906,495	N413K	probably damaging	Het
Stam2	C	T	2: 52,716,451	V141I	probably benign	Het
Stim1	C	T	7: 102,411,275	T175I	probably benign	Het
Strap	A	G	6: 137,739,813	N130S	probably benign	Het
Stxbp2	A	G	8: 3,642,627		probably benign	Het
Sult3a2	T	A	10: 33,779,693	I97F	probably benign	Het
Tbc1d32	A	T	10: 56,072,597	N965K	probably benign	Het
Tle3	T	A	9: 61,412,468	I506N	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Tvp23a	A	G	16: 10,446,982	S22P	probably damaging	Het
Vmn2r82	A	G	10: 79,396,705	N846S	probably damaging	Het
Vmn2r83	A	G	10: 79,480,186	N472S	probably damaging	Het
Xpo7	G	A	14: 70,707,424	Q10*	probably null	Het
Zfp423	G	C	8: 87,781,753	S654R	probably benign	Het
Zfp646	A	T	7: 127,879,071	H140L	probably benign	Het
Zfp719	C	A	7: 43,584,065		probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAAGCAGGAGTGTGACTC -3'
(R):5'- TTACAGCCAAGACAGGGTCC -3'

Sequencing Primer
(F):5'- AGTGTGACTCCTTGGACCC -3'
(R):5'- CTGCACTATCTGTACCTGGGG -3'

Posted On

2021-10-11