Incidental Mutation 'R9018:Greb1l'
ID 686176
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9018 (G1)
Quality Score 195.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10542004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1250 (D1250E)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000048977
AA Change: D1250E

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D1250E

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mapk13 C T 17: 28,996,760 (GRCm39) R276C probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or5b118 A T 19: 13,448,721 (GRCm39) H87L possibly damaging Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Pole T A 5: 110,437,675 (GRCm39) L78I probably benign Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
Smarca5 A G 8: 81,431,355 (GRCm39) L954P probably damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Stim1 C T 7: 102,060,482 (GRCm39) T175I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGCAGGAGTGTGACTC -3'
(R):5'- TTACAGCCAAGACAGGGTCC -3'

Sequencing Primer
(F):5'- AGTGTGACTCCTTGGACCC -3'
(R):5'- CTGCACTATCTGTACCTGGGG -3'
Posted On 2021-10-11