Incidental Mutation 'R9018:Or5b118'
ID 686177
Institutional Source Beutler Lab
Gene Symbol Or5b118
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor family 5 subfamily B member 118
Synonyms Olfr1474, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527, MOR202-42
MMRRC Submission 068848-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R9018 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 13448336-13449280 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13448721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 87 (H87L)
Ref Sequence ENSEMBL: ENSMUSP00000147143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000096202
AA Change: H129L

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: H129L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207529
AA Change: H87L

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220113
AA Change: H129L

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,918,532 (GRCm39) E1552G probably damaging Het
Abca14 A T 7: 119,888,763 (GRCm39) K1236N probably benign Het
Adam3 A T 8: 25,184,292 (GRCm39) Y569* probably null Het
Adgrb2 A G 4: 129,907,659 (GRCm39) T998A probably benign Het
Adgre4 T A 17: 56,098,993 (GRCm39) H166Q probably benign Het
Ank1 G A 8: 23,606,264 (GRCm39) G1219S probably null Het
Ankrd11 A G 8: 123,622,251 (GRCm39) S534P probably damaging Het
Atn1 C T 6: 124,722,661 (GRCm39) E805K unknown Het
Bsn T C 9: 107,994,488 (GRCm39) T596A probably benign Het
Cacnb4 C T 2: 52,324,706 (GRCm39) R452Q probably benign Het
Cdc123 C A 2: 5,849,683 (GRCm39) A13S probably benign Het
Chd7 G A 4: 8,847,083 (GRCm39) G1609S possibly damaging Het
Cp T A 3: 20,043,316 (GRCm39) C1035S probably damaging Het
Dcaf1 T A 9: 106,742,836 (GRCm39) C1383S probably damaging Het
Derl3 G A 10: 75,729,604 (GRCm39) V54I probably benign Het
Dgcr6 T C 16: 17,884,607 (GRCm39) L25P probably damaging Het
Dmrt2 A G 19: 25,650,985 (GRCm39) E57G probably benign Het
Dnaaf11 A T 15: 66,321,479 (GRCm39) S221T probably benign Het
Dst A G 1: 34,235,140 (GRCm39) K3562E probably damaging Het
Dyrk2 T C 10: 118,696,014 (GRCm39) T415A probably damaging Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbln1 T C 15: 85,126,215 (GRCm39) I484T probably damaging Het
Greb1l T A 18: 10,542,004 (GRCm39) D1250E possibly damaging Het
Ift88 A C 14: 57,675,702 (GRCm39) K72Q probably benign Het
Impg1 T A 9: 80,301,474 (GRCm39) I228F probably benign Het
Itsn2 A G 12: 4,708,091 (GRCm39) N799S possibly damaging Het
Jade1 T A 3: 41,564,292 (GRCm39) C521S probably benign Het
Katna1 T G 10: 7,637,040 (GRCm39) L397R probably damaging Het
Kcnj15 A C 16: 95,097,129 (GRCm39) K250N probably damaging Het
Macc1 A G 12: 119,409,941 (GRCm39) I236M possibly damaging Het
Mapk13 C T 17: 28,996,760 (GRCm39) R276C probably benign Het
Mier2 G A 10: 79,384,274 (GRCm39) R166W probably damaging Het
Mindy4 C T 6: 55,278,072 (GRCm39) H639Y possibly damaging Het
Mphosph9 A G 5: 124,436,713 (GRCm39) S544P probably benign Het
Muc4 T C 16: 32,582,910 (GRCm39) Y492H Het
Mybbp1a C T 11: 72,334,420 (GRCm39) T225I probably benign Het
Myo6 A T 9: 80,159,086 (GRCm39) K285I unknown Het
Nmd3 G A 3: 69,647,328 (GRCm39) V277I probably benign Het
Nol9 G C 4: 152,123,918 (GRCm39) R36P probably damaging Het
Nom1 A G 5: 29,639,712 (GRCm39) R13G possibly damaging Het
Nudt14 G A 12: 112,902,906 (GRCm39) H40Y probably damaging Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Or1x6 G A 11: 50,938,938 (GRCm39) M1I probably null Het
Or8d1b T A 9: 38,887,687 (GRCm39) F238L probably benign Het
Pcnx4 T A 12: 72,603,437 (GRCm39) F492I probably damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 171,956,150 (GRCm39) probably null Het
Pgghg A G 7: 140,524,579 (GRCm39) I309V probably benign Het
Phf12 C T 11: 77,914,510 (GRCm39) P651S possibly damaging Het
Pltp A G 2: 164,694,410 (GRCm39) L199P probably damaging Het
Pole T A 5: 110,437,675 (GRCm39) L78I probably benign Het
Ppm1d C A 11: 85,227,961 (GRCm39) H292Q probably damaging Het
Ppp2cb A C 8: 34,105,787 (GRCm39) I224L probably benign Het
Rabggta A T 14: 55,957,880 (GRCm39) I171N probably damaging Het
Rapgef5 A G 12: 117,712,132 (GRCm39) I740V probably damaging Het
Rb1cc1 G A 1: 6,319,490 (GRCm39) E970K probably benign Het
Rnh1 A T 7: 140,748,544 (GRCm39) V11D probably benign Het
Robo4 C T 9: 37,315,520 (GRCm39) T288I probably benign Het
Scmh1 A G 4: 120,362,514 (GRCm39) D250G probably benign Het
Sele T A 1: 163,881,248 (GRCm39) C483S probably damaging Het
Slc12a6 A G 2: 112,174,585 (GRCm39) probably benign Het
Slc5a4a A G 10: 76,002,546 (GRCm39) E234G possibly damaging Het
Smarca5 A G 8: 81,431,355 (GRCm39) L954P probably damaging Het
St7 T A 6: 17,906,494 (GRCm39) N413K probably damaging Het
Stam2 C T 2: 52,606,463 (GRCm39) V141I probably benign Het
Stim1 C T 7: 102,060,482 (GRCm39) T175I probably benign Het
Strap A G 6: 137,716,811 (GRCm39) N130S probably benign Het
Stxbp2 A G 8: 3,692,627 (GRCm39) probably benign Het
Sult3a2 T A 10: 33,655,689 (GRCm39) I97F probably benign Het
Tbc1d32 A T 10: 55,948,693 (GRCm39) N965K probably benign Het
Tle3 T A 9: 61,319,750 (GRCm39) I506N probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tvp23a A G 16: 10,264,846 (GRCm39) S22P probably damaging Het
Vmn2r82 A G 10: 79,232,539 (GRCm39) N846S probably damaging Het
Vmn2r83 A G 10: 79,316,020 (GRCm39) N472S probably damaging Het
Xpo7 G A 14: 70,944,864 (GRCm39) Q10* probably null Het
Zfp423 G C 8: 88,508,381 (GRCm39) S654R probably benign Het
Zfp646 A T 7: 127,478,243 (GRCm39) H140L probably benign Het
Zfp719 C A 7: 43,233,489 (GRCm39) probably benign Het
Other mutations in Or5b118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Or5b118 APN 19 13,448,631 (GRCm39) missense probably damaging 0.99
D605:Or5b118 UTSW 19 13,448,521 (GRCm39) nonsense probably null
R0173:Or5b118 UTSW 19 13,449,065 (GRCm39) missense probably benign 0.02
R1102:Or5b118 UTSW 19 13,448,771 (GRCm39) missense probably damaging 0.97
R1515:Or5b118 UTSW 19 13,449,044 (GRCm39) missense probably damaging 0.97
R1780:Or5b118 UTSW 19 13,448,726 (GRCm39) missense probably benign 0.14
R2061:Or5b118 UTSW 19 13,448,605 (GRCm39) missense probably damaging 0.98
R4016:Or5b118 UTSW 19 13,448,561 (GRCm39) missense possibly damaging 0.95
R4485:Or5b118 UTSW 19 13,448,919 (GRCm39) missense probably benign 0.08
R5119:Or5b118 UTSW 19 13,448,910 (GRCm39) missense probably benign 0.00
R5150:Or5b118 UTSW 19 13,448,794 (GRCm39) missense probably benign 0.01
R5156:Or5b118 UTSW 19 13,449,037 (GRCm39) missense probably damaging 1.00
R5699:Or5b118 UTSW 19 13,448,336 (GRCm39) start codon destroyed probably null 0.78
R5800:Or5b118 UTSW 19 13,449,260 (GRCm39) missense probably benign 0.06
R5840:Or5b118 UTSW 19 13,449,242 (GRCm39) missense probably benign 0.01
R5953:Or5b118 UTSW 19 13,448,732 (GRCm39) missense possibly damaging 0.92
R5997:Or5b118 UTSW 19 13,448,870 (GRCm39) missense probably benign 0.12
R6233:Or5b118 UTSW 19 13,449,104 (GRCm39) missense probably damaging 1.00
R6488:Or5b118 UTSW 19 13,448,981 (GRCm39) missense probably damaging 1.00
R6847:Or5b118 UTSW 19 13,448,402 (GRCm39) missense probably benign 0.03
R6964:Or5b118 UTSW 19 13,448,725 (GRCm39) nonsense probably null
R7214:Or5b118 UTSW 19 13,448,337 (GRCm39) start codon destroyed probably null 1.00
R8001:Or5b118 UTSW 19 13,448,786 (GRCm39) missense probably benign 0.03
R8035:Or5b118 UTSW 19 13,449,263 (GRCm39) missense probably benign
R8129:Or5b118 UTSW 19 13,448,508 (GRCm39) missense probably damaging 1.00
R9061:Or5b118 UTSW 19 13,448,523 (GRCm39) missense probably damaging 0.98
R9065:Or5b118 UTSW 19 13,448,670 (GRCm39) missense probably damaging 0.97
R9373:Or5b118 UTSW 19 13,449,216 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGTGTTTATGCCTCAGC -3'
(R):5'- GCCAAGACGAGCAGTGTAATCTC -3'

Sequencing Primer
(F):5'- TCAGCAATCACCCCCAAGG -3'
(R):5'- GACGAGCAGTGTAATCTCATTTG -3'
Posted On 2021-10-11