Incidental Mutation 'R9021:Col6a6'
ID 686220
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R9021 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 105687809-105828160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105709546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1759 (F1759I)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect possibly damaging
Transcript: ENSMUST00000098441
AA Change: F1759I

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: F1759I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166431
AA Change: F1759I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: F1759I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,998,344 D3064E probably benign Het
Acad11 A G 9: 104,126,665 D770G possibly damaging Het
Amph G A 13: 19,099,901 G200D probably benign Het
Asap2 T A 12: 21,203,998 L170H possibly damaging Het
Asap3 T C 4: 136,238,988 probably null Het
Atxn2l A T 7: 126,495,540 M595K probably benign Het
Ccnf A T 17: 24,226,705 Y522* probably null Het
Ceacam5 A T 7: 17,714,952 Y81F possibly damaging Het
Chd2 A T 7: 73,441,645 M1616K probably benign Het
Clint1 T A 11: 45,906,215 S374R probably benign Het
Crocc T A 4: 141,022,363 I1487F probably benign Het
Dll4 TC T 2: 119,332,573 probably null Het
Dopey1 T C 9: 86,520,437 I1230T probably benign Het
Dsp A T 13: 38,196,832 I2518L possibly damaging Het
Eps8l2 G T 7: 141,356,204 V224L possibly damaging Het
Etv1 T C 12: 38,780,972 V13A probably benign Het
Fam78a T C 2: 32,069,301 M266V probably benign Het
Fam81a A G 9: 70,110,256 probably null Het
Fhad1 T C 4: 141,982,309 I245V probably damaging Het
Flot2 T C 11: 78,058,979 V378A probably benign Het
Fras1 T A 5: 96,740,750 S2718R probably damaging Het
Gm14305 A G 2: 176,721,374 K353R possibly damaging Het
Inppl1 A C 7: 101,831,708 V315G probably damaging Het
Kbtbd6 A T 14: 79,453,382 I506F probably damaging Het
Klf6 G C 13: 5,865,161 G200R probably benign Het
Lrp6 A G 6: 134,541,967 I45T probably benign Het
Lrriq4 T G 3: 30,650,252 V143G probably benign Het
Map2k2 G T 10: 81,119,325 G217C probably damaging Het
Mcm10 T C 2: 4,992,971 N813S probably benign Het
Mfng T A 15: 78,773,148 N42I probably benign Het
Mical1 A G 10: 41,485,145 D808G probably benign Het
Mmp14 T C 14: 54,436,175 F99L probably benign Het
Mroh8 A T 2: 157,222,867 V763E probably benign Het
Mycbp2 G T 14: 103,314,316 P193T probably benign Het
Myo1b T C 1: 51,781,983 D447G possibly damaging Het
Narf C A 11: 121,245,383 P195Q probably damaging Het
Nfatc3 T A 8: 106,092,113 F496I probably damaging Het
Nudt13 A G 14: 20,310,704 Y225C probably damaging Het
Olfr509 A T 7: 108,646,221 Y118* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr749 T G 14: 50,737,097 I22L probably benign Het
Olfr94 G T 17: 37,197,489 R85S possibly damaging Het
Osbpl10 C T 9: 114,978,871 A65V unknown Het
Pdcd2l A G 7: 34,186,335 L308P probably damaging Het
Pitx2 T A 3: 129,214,783 probably null Het
Pms2 T A 5: 143,925,926 F617Y probably damaging Het
Poc1b A G 10: 99,144,321 N180S possibly damaging Het
Poln T A 5: 34,129,141 M228L probably benign Het
Prex1 C A 2: 166,590,509 V707F possibly damaging Het
Rasal2 A T 1: 157,230,944 V12D unknown Het
Ripk1 A G 13: 34,021,390 E284G probably benign Het
Rpa2 T C 4: 132,771,940 W107R probably damaging Het
Selp A G 1: 164,126,608 Y159C probably damaging Het
Serpina1a A T 12: 103,858,034 W30R probably benign Het
Skiv2l A G 17: 34,846,603 V325A probably damaging Het
Slco6d1 A G 1: 98,443,671 R294G probably benign Het
Supt5 A T 7: 28,317,246 I737N probably damaging Het
Thap11 T C 8: 105,856,028 V223A probably damaging Het
Trabd T A 15: 89,084,710 S144T possibly damaging Het
Trim24 T A 6: 37,957,014 S701T probably damaging Het
Trim52 C T 14: 106,107,552 P215S possibly damaging Het
Vmn1r172 G T 7: 23,660,324 L211F probably damaging Het
Vmn2r86 A C 10: 130,447,065 Y561D probably damaging Het
Zfp384 C A 6: 125,036,373 A468E Het
Zfp658 A G 7: 43,573,957 H552R possibly damaging Het
Zranb2 T C 3: 157,545,083 V297A unknown Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105774788 missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105786149 missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105767329 missense probably damaging 0.99
R9088:Col6a6 UTSW 9 105784077 missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105781970 missense probably benign 0.30
R9225:Col6a6 UTSW 9 105782238 missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105774558 missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105785973 missense probably benign 0.00
R9360:Col6a6 UTSW 9 105767487 missense probably benign 0.00
R9368:Col6a6 UTSW 9 105786101 missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105774626 missense probably benign 0.40
R9450:Col6a6 UTSW 9 105784174 missense probably benign
R9454:Col6a6 UTSW 9 105783860 missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105709162 missense probably benign 0.01
R9563:Col6a6 UTSW 9 105695753 missense probably benign 0.02
R9568:Col6a6 UTSW 9 105780727 missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105739202 missense probably benign 0.07
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- TGTAGGCATCTGAGAAGCGG -3'
(R):5'- AGCCAGCTTTTAGAACAGCC -3'

Sequencing Primer
(F):5'- AGCGGATGAGGTGCCTG -3'
(R):5'- CAGCCATTTTAATGATTCAAGCTG -3'
Posted On 2021-10-11