Incidental Mutation 'R9022:Adgrv1'
ID 686307
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 81095068-81633154 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81155193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 6125 (W6125R)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585] [ENSMUST00000128120] [ENSMUST00000224088]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000095585
AA Change: W6125R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: W6125R

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128120
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122358
Gene: ENSMUSG00000069170
AA Change: W145R

DomainStartEndE-ValueType
Pfam:7tm_2 1 161 4.4e-8 PFAM
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224088
AA Change: W145R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G T 3: 32,715,500 A155S probably benign Het
Adar A G 3: 89,735,738 T309A probably benign Het
Adprhl1 A G 8: 13,224,352 L802P probably benign Het
Ahcy A G 2: 155,068,859 L63P probably damaging Het
Ang5 G A 14: 43,962,895 D139N probably damaging Het
Ankrd31 A G 13: 96,826,147 D482G probably benign Het
Arhgef7 A G 8: 11,800,469 N257D probably benign Het
Art3 C A 5: 92,392,534 S45R probably benign Het
Atxn1 T C 13: 45,567,415 R335G probably damaging Het
Bag6 T A 17: 35,144,665 L775H probably damaging Het
BC004004 T G 17: 29,282,156 H26Q possibly damaging Het
Camsap3 T C 8: 3,606,575 L986S probably benign Het
Cbx5 T C 15: 103,213,159 E17G probably damaging Het
Cc2d1b T C 4: 108,627,420 probably null Het
Ccdc59 T C 10: 105,847,146 Y231H probably damaging Het
Csnk1g1 T C 9: 66,010,572 probably null Het
Cybrd1 A G 2: 71,137,560 I158M possibly damaging Het
Dirc2 T C 16: 35,750,542 T131A probably benign Het
Disp2 T A 2: 118,790,698 I637N probably benign Het
Dll4 TC T 2: 119,332,573 probably null Het
Dnah7a T C 1: 53,472,957 probably null Het
Duox2 C A 2: 122,280,438 *1518L probably null Het
Dym A G 18: 75,125,436 I422V probably benign Het
Entpd8 A C 2: 25,085,132 I492L probably benign Het
Fabp12 A G 3: 10,252,273 S13P probably damaging Het
Fam124b A G 1: 80,212,988 I226T probably damaging Het
Fam208b A G 13: 3,576,659 V1097A probably benign Het
Fer1l6 T C 15: 58,583,480 L763P probably damaging Het
Git2 A G 5: 114,769,615 probably null Het
Gltpd2 A T 11: 70,519,327 Y37F probably benign Het
Gm44511 T G 6: 128,820,308 Q72H possibly damaging Het
Grid2ip A T 5: 143,380,449 T565S probably benign Het
Grk6 T C 13: 55,459,064 S532P possibly damaging Het
Haspin A T 11: 73,136,005 F753I probably damaging Het
Herpud1 T A 8: 94,389,569 S92T possibly damaging Het
Heyl C T 4: 123,245,975 A109V probably damaging Het
Hivep3 T C 4: 120,098,107 S1207P probably benign Het
Hk1 A G 10: 62,269,989 S893P probably damaging Het
Itih1 C A 14: 30,930,370 V789L probably benign Het
Kif12 T C 4: 63,171,884 D10G possibly damaging Het
Kif16b C T 2: 142,712,617 E754K possibly damaging Het
Kif20a A G 18: 34,627,845 Q191R probably benign Het
Lap3 A G 5: 45,495,206 D48G probably benign Het
Matn3 T A 12: 8,952,355 V189E probably damaging Het
Mbp G A 18: 82,578,942 E143K possibly damaging Het
Mrgprd A G 7: 145,321,818 H142R probably benign Het
Nbea A T 3: 55,643,689 C2685S possibly damaging Het
Nhsl1 A C 10: 18,527,661 I1381L possibly damaging Het
Npc1 A G 18: 12,213,365 M258T probably benign Het
Olfr18 T A 9: 20,313,972 N316I probably damaging Het
Olfr322 T C 11: 58,665,724 L55P probably damaging Het
Osbpl10 C T 9: 114,978,871 A65V unknown Het
Pdia4 C G 6: 47,808,215 A73P probably benign Het
Plxnb2 T C 15: 89,164,268 Y646C possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pold2 T C 11: 5,874,121 D228G probably benign Het
Popdc2 T G 16: 38,374,146 C310G probably benign Het
Prdm10 A G 9: 31,357,128 Y791C probably benign Het
Psg19 C T 7: 18,796,837 V131I probably benign Het
Psg19 T A 7: 18,797,119 T37S probably benign Het
Psme1 A G 14: 55,579,814 E39G probably damaging Het
Rabep2 A G 7: 126,444,547 E472G probably damaging Het
Rap1gap T C 4: 137,717,998 F297S probably damaging Het
Reln A G 5: 21,976,615 S1757P possibly damaging Het
Rybp G T 6: 100,233,113 D95E possibly damaging Het
Slc12a8 T A 16: 33,646,564 D480E probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc25a24 A T 3: 109,163,441 D372V probably benign Het
Stab1 T C 14: 31,160,269 T490A probably benign Het
Stat5b A T 11: 100,790,808 I540N probably benign Het
Thy1 T A 9: 44,046,650 L25Q probably damaging Het
Tmem2 T C 19: 21,812,622 probably null Het
Trim30a A G 7: 104,435,749 S85P probably benign Het
Use1 G A 8: 71,367,298 V36I probably benign Het
Vmn1r228 T A 17: 20,776,516 I247F probably damaging Het
Vmn2r13 T A 5: 109,156,376 T730S possibly damaging Het
Vmn2r9 T C 5: 108,845,057 D529G possibly damaging Het
Washc5 A G 15: 59,345,384 I778T possibly damaging Het
Washc5 A T 15: 59,361,220 M294K probably damaging Het
Wnt8a A T 18: 34,547,245 D221V probably damaging Het
Zfp616 A G 11: 74,085,713 K936R probably damaging Het
Zfp618 G A 4: 63,094,450 C133Y probably damaging Het
Zfp82 A G 7: 30,062,289 S56P probably damaging Het
Zkscan16 T A 4: 58,957,021 D434E probably benign Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 splice site probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556 splice site probably benign
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
abetting UTSW 13 81579560 missense probably damaging 1.00
beatle UTSW 13 81579594 nonsense probably null
Escape UTSW 13 81435705 missense probably benign 0.02
lento UTSW 13 81270897 missense probably damaging 1.00
Metronome UTSW 13 81435559 critical splice donor site probably null
Murderous UTSW 13 81103324 missense possibly damaging 0.94
Nome UTSW 13 81391767 missense probably benign 0.00
Propulsion UTSW 13 81475047 missense probably benign 0.06
revulsion UTSW 13 81595182 missense probably damaging 1.00
Saturnv UTSW 13 81531676 missense probably damaging 1.00
Thrust UTSW 13 81374256 missense probably benign 0.01
Velocity UTSW 13 81397354 missense probably benign 0.00
Wilting UTSW 13 81492501 missense probably benign 0.02
Withering UTSW 13 81494657 missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
G1patch:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81528985 missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81559352 missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81386788 missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 splice site probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81593060 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81459763 splice site probably null
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 splice site probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81106931 missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 splice site probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81522104 critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81536364 missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81561474 missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81270897 missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81578142 missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81592574 missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81492501 missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81397209 missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81479658 missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81476612 missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81374259 missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81520515 missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81560689 missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81559348 missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81563619 missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81499073 missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81433529 missense probably benign 0.00
R7567:Adgrv1 UTSW 13 81579477 missense probably damaging 1.00
R7614:Adgrv1 UTSW 13 81520661 missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81422225 missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81499142 missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81103324 missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81573314 missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81528641 missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81593088 missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81567451 missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81559529 missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81559588 missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81155234 missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81563570 missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81283466 missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81413177 missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81448834 critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8125:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81522121 missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81528914 missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81579560 missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81503044 missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81481883 missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81385914 nonsense probably null
R8317:Adgrv1 UTSW 13 81575117 missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81445343 missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81445343 missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81445343 missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81445343 missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81103386 missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81182678 missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81489170 missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81435843 splice site probably null
R8471:Adgrv1 UTSW 13 81446472 missense probably benign 0.00
R8534:Adgrv1 UTSW 13 81386768 missense probably benign 0.02
R8537:Adgrv1 UTSW 13 81536372 missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81528673 missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81481359 missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81488906 critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81521205 missense probably benign
R8856:Adgrv1 UTSW 13 81559502 missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81567439 missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81419469 missense probably benign
R8994:Adgrv1 UTSW 13 81405338 frame shift probably null
R8995:Adgrv1 UTSW 13 81405338 frame shift probably null
R8996:Adgrv1 UTSW 13 81405338 frame shift probably null
R8997:Adgrv1 UTSW 13 81405338 frame shift probably null
R9059:Adgrv1 UTSW 13 81414573 critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81422128 critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81510876 missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81540014 missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81413172 missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81521183 missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81419422 missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81103372 missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81446401 missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81472404 missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81499122 missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81506155 missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81557158 missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81476648 missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81508768 missense not run
R9427:Adgrv1 UTSW 13 81584115 missense not run
R9429:Adgrv1 UTSW 13 81419349 missense not run
R9429:Adgrv1 UTSW 13 81593046 missense not run
R9433:Adgrv1 UTSW 13 81566352 missense not run
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81559634 missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81419256 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGTAGATACACATGCCCCATG -3'
(R):5'- GAACTGTGGCTCTGCACAATG -3'

Sequencing Primer
(F):5'- CCATCGTTACCGTCTGATTAAAAAC -3'
(R):5'- AGGAAGGATTTCAAAGGTTGTTTCC -3'
Posted On 2021-10-11