Incidental Mutation 'R9022:Fer1l6'
ID 686313
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9022 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58583480 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 763 (L763P)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: L763P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: L763P

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G T 3: 32,715,500 A155S probably benign Het
Adar A G 3: 89,735,738 T309A probably benign Het
Adgrv1 A T 13: 81,155,193 W6125R probably damaging Het
Adprhl1 A G 8: 13,224,352 L802P probably benign Het
Ahcy A G 2: 155,068,859 L63P probably damaging Het
Ang5 G A 14: 43,962,895 D139N probably damaging Het
Ankrd31 A G 13: 96,826,147 D482G probably benign Het
Arhgef7 A G 8: 11,800,469 N257D probably benign Het
Art3 C A 5: 92,392,534 S45R probably benign Het
Atxn1 T C 13: 45,567,415 R335G probably damaging Het
Bag6 T A 17: 35,144,665 L775H probably damaging Het
BC004004 T G 17: 29,282,156 H26Q possibly damaging Het
Camsap3 T C 8: 3,606,575 L986S probably benign Het
Cbx5 T C 15: 103,213,159 E17G probably damaging Het
Cc2d1b T C 4: 108,627,420 probably null Het
Ccdc59 T C 10: 105,847,146 Y231H probably damaging Het
Csnk1g1 T C 9: 66,010,572 probably null Het
Cybrd1 A G 2: 71,137,560 I158M possibly damaging Het
Dirc2 T C 16: 35,750,542 T131A probably benign Het
Disp2 T A 2: 118,790,698 I637N probably benign Het
Dll4 TC T 2: 119,332,573 probably null Het
Dnah7a T C 1: 53,472,957 probably null Het
Duox2 C A 2: 122,280,438 *1518L probably null Het
Dym A G 18: 75,125,436 I422V probably benign Het
Entpd8 A C 2: 25,085,132 I492L probably benign Het
Fabp12 A G 3: 10,252,273 S13P probably damaging Het
Fam124b A G 1: 80,212,988 I226T probably damaging Het
Fam208b A G 13: 3,576,659 V1097A probably benign Het
Git2 A G 5: 114,769,615 probably null Het
Gltpd2 A T 11: 70,519,327 Y37F probably benign Het
Gm44511 T G 6: 128,820,308 Q72H possibly damaging Het
Grid2ip A T 5: 143,380,449 T565S probably benign Het
Grk6 T C 13: 55,459,064 S532P possibly damaging Het
Haspin A T 11: 73,136,005 F753I probably damaging Het
Herpud1 T A 8: 94,389,569 S92T possibly damaging Het
Heyl C T 4: 123,245,975 A109V probably damaging Het
Hivep3 T C 4: 120,098,107 S1207P probably benign Het
Hk1 A G 10: 62,269,989 S893P probably damaging Het
Itih1 C A 14: 30,930,370 V789L probably benign Het
Kif12 T C 4: 63,171,884 D10G possibly damaging Het
Kif16b C T 2: 142,712,617 E754K possibly damaging Het
Kif20a A G 18: 34,627,845 Q191R probably benign Het
Lap3 A G 5: 45,495,206 D48G probably benign Het
Matn3 T A 12: 8,952,355 V189E probably damaging Het
Mbp G A 18: 82,578,942 E143K possibly damaging Het
Mrgprd A G 7: 145,321,818 H142R probably benign Het
Nbea A T 3: 55,643,689 C2685S possibly damaging Het
Nhsl1 A C 10: 18,527,661 I1381L possibly damaging Het
Npc1 A G 18: 12,213,365 M258T probably benign Het
Olfr18 T A 9: 20,313,972 N316I probably damaging Het
Olfr322 T C 11: 58,665,724 L55P probably damaging Het
Osbpl10 C T 9: 114,978,871 A65V unknown Het
Pdia4 C G 6: 47,808,215 A73P probably benign Het
Plxnb2 T C 15: 89,164,268 Y646C possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pold2 T C 11: 5,874,121 D228G probably benign Het
Popdc2 T G 16: 38,374,146 C310G probably benign Het
Prdm10 A G 9: 31,357,128 Y791C probably benign Het
Psg19 C T 7: 18,796,837 V131I probably benign Het
Psg19 T A 7: 18,797,119 T37S probably benign Het
Psme1 A G 14: 55,579,814 E39G probably damaging Het
Rabep2 A G 7: 126,444,547 E472G probably damaging Het
Rap1gap T C 4: 137,717,998 F297S probably damaging Het
Reln A G 5: 21,976,615 S1757P possibly damaging Het
Rybp G T 6: 100,233,113 D95E possibly damaging Het
Slc12a8 T A 16: 33,646,564 D480E probably benign Het
Slc25a1 A G 16: 17,927,430 V80A probably benign Het
Slc25a24 A T 3: 109,163,441 D372V probably benign Het
Stab1 T C 14: 31,160,269 T490A probably benign Het
Stat5b A T 11: 100,790,808 I540N probably benign Het
Thy1 T A 9: 44,046,650 L25Q probably damaging Het
Tmem2 T C 19: 21,812,622 probably null Het
Trim30a A G 7: 104,435,749 S85P probably benign Het
Use1 G A 8: 71,367,298 V36I probably benign Het
Vmn1r228 T A 17: 20,776,516 I247F probably damaging Het
Vmn2r13 T A 5: 109,156,376 T730S possibly damaging Het
Vmn2r9 T C 5: 108,845,057 D529G possibly damaging Het
Washc5 A G 15: 59,345,384 I778T possibly damaging Het
Washc5 A T 15: 59,361,220 M294K probably damaging Het
Wnt8a A T 18: 34,547,245 D221V probably damaging Het
Zfp616 A G 11: 74,085,713 K936R probably damaging Het
Zfp618 G A 4: 63,094,450 C133Y probably damaging Het
Zfp82 A G 7: 30,062,289 S56P probably damaging Het
Zkscan16 T A 4: 58,957,021 D434E probably benign Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGGGATAGGTAAGCC -3'
(R):5'- TGCTAGAAGAAACCACTCAATTGG -3'

Sequencing Primer
(F):5'- TAGGTAAGCCCTAGAGGTACATCTAC -3'
(R):5'- GAATTTAGATCAAGAAGCCTACGGTC -3'
Posted On 2021-10-11