Incidental Mutation 'R9022:Vmn1r228'
ID 686323
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission 068852-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R9022 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20996778 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 247 (I247F)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect probably damaging
Transcript: ENSMUST00000072410
AA Change: I247F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: I247F

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Meta Mutation Damage Score 0.6025 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G T 3: 32,769,649 (GRCm39) A155S probably benign Het
Adar A G 3: 89,643,045 (GRCm39) T309A probably benign Het
Adgrv1 A T 13: 81,303,312 (GRCm39) W6125R probably damaging Het
Adprhl1 A G 8: 13,274,352 (GRCm39) L802P probably benign Het
Ahcy A G 2: 154,910,779 (GRCm39) L63P probably damaging Het
Ang5 G A 14: 44,200,352 (GRCm39) D139N probably damaging Het
Ankrd31 A G 13: 96,962,655 (GRCm39) D482G probably benign Het
Arhgef7 A G 8: 11,850,469 (GRCm39) N257D probably benign Het
Art3 C A 5: 92,540,393 (GRCm39) S45R probably benign Het
Atxn1 T C 13: 45,720,891 (GRCm39) R335G probably damaging Het
Bag6 T A 17: 35,363,641 (GRCm39) L775H probably damaging Het
BC004004 T G 17: 29,501,130 (GRCm39) H26Q possibly damaging Het
Camsap3 T C 8: 3,656,575 (GRCm39) L986S probably benign Het
Cbx5 T C 15: 103,121,586 (GRCm39) E17G probably damaging Het
Cc2d1b T C 4: 108,484,617 (GRCm39) probably null Het
Ccdc59 T C 10: 105,683,007 (GRCm39) Y231H probably damaging Het
Cemip2 T C 19: 21,789,986 (GRCm39) probably null Het
Csnk1g1 T C 9: 65,917,854 (GRCm39) probably null Het
Cybrd1 A G 2: 70,967,904 (GRCm39) I158M possibly damaging Het
Disp2 T A 2: 118,621,179 (GRCm39) I637N probably benign Het
Dll4 TC T 2: 119,163,054 (GRCm39) probably null Het
Dnah7a T C 1: 53,512,116 (GRCm39) probably null Het
Duox2 C A 2: 122,110,919 (GRCm39) *1518L probably null Het
Dym A G 18: 75,258,507 (GRCm39) I422V probably benign Het
Entpd8 A C 2: 24,975,144 (GRCm39) I492L probably benign Het
Fabp12 A G 3: 10,317,333 (GRCm39) S13P probably damaging Het
Fam124b A G 1: 80,190,705 (GRCm39) I226T probably damaging Het
Fer1l6 T C 15: 58,455,329 (GRCm39) L763P probably damaging Het
Git2 A G 5: 114,907,676 (GRCm39) probably null Het
Gltpd2 A T 11: 70,410,153 (GRCm39) Y37F probably benign Het
Gm44511 T G 6: 128,797,271 (GRCm39) Q72H possibly damaging Het
Grid2ip A T 5: 143,366,204 (GRCm39) T565S probably benign Het
Grk6 T C 13: 55,606,877 (GRCm39) S532P possibly damaging Het
Haspin A T 11: 73,026,831 (GRCm39) F753I probably damaging Het
Herpud1 T A 8: 95,116,197 (GRCm39) S92T possibly damaging Het
Heyl C T 4: 123,139,768 (GRCm39) A109V probably damaging Het
Hivep3 T C 4: 119,955,304 (GRCm39) S1207P probably benign Het
Hk1 A G 10: 62,105,768 (GRCm39) S893P probably damaging Het
Itih1 C A 14: 30,652,327 (GRCm39) V789L probably benign Het
Kif12 T C 4: 63,090,121 (GRCm39) D10G possibly damaging Het
Kif16b C T 2: 142,554,537 (GRCm39) E754K possibly damaging Het
Kif20a A G 18: 34,760,898 (GRCm39) Q191R probably benign Het
Lap3 A G 5: 45,652,548 (GRCm39) D48G probably benign Het
Matn3 T A 12: 9,002,355 (GRCm39) V189E probably damaging Het
Mbp G A 18: 82,597,067 (GRCm39) E143K possibly damaging Het
Mrgprd A G 7: 144,875,555 (GRCm39) H142R probably benign Het
Nbea A T 3: 55,551,110 (GRCm39) C2685S possibly damaging Het
Nhsl1 A C 10: 18,403,409 (GRCm39) I1381L possibly damaging Het
Npc1 A G 18: 12,346,422 (GRCm39) M258T probably benign Het
Or2w3 T C 11: 58,556,550 (GRCm39) L55P probably damaging Het
Or7e178 T A 9: 20,225,268 (GRCm39) N316I probably damaging Het
Osbpl10 C T 9: 114,807,939 (GRCm39) A65V unknown Het
Pdia4 C G 6: 47,785,149 (GRCm39) A73P probably benign Het
Plxnb2 T C 15: 89,048,471 (GRCm39) Y646C possibly damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pold2 T C 11: 5,824,121 (GRCm39) D228G probably benign Het
Popdc2 T G 16: 38,194,508 (GRCm39) C310G probably benign Het
Prdm10 A G 9: 31,268,424 (GRCm39) Y791C probably benign Het
Psg19 C T 7: 18,530,762 (GRCm39) V131I probably benign Het
Psg19 T A 7: 18,531,044 (GRCm39) T37S probably benign Het
Psme1 A G 14: 55,817,271 (GRCm39) E39G probably damaging Het
Rabep2 A G 7: 126,043,719 (GRCm39) E472G probably damaging Het
Rap1gap T C 4: 137,445,309 (GRCm39) F297S probably damaging Het
Reln A G 5: 22,181,613 (GRCm39) S1757P possibly damaging Het
Rybp G T 6: 100,210,074 (GRCm39) D95E possibly damaging Het
Slc12a8 T A 16: 33,466,934 (GRCm39) D480E probably benign Het
Slc25a1 A G 16: 17,745,294 (GRCm39) V80A probably benign Het
Slc25a24 A T 3: 109,070,757 (GRCm39) D372V probably benign Het
Slc49a4 T C 16: 35,570,912 (GRCm39) T131A probably benign Het
Stab1 T C 14: 30,882,226 (GRCm39) T490A probably benign Het
Stat5b A T 11: 100,681,634 (GRCm39) I540N probably benign Het
Tasor2 A G 13: 3,626,659 (GRCm39) V1097A probably benign Het
Thy1 T A 9: 43,957,947 (GRCm39) L25Q probably damaging Het
Trim30a A G 7: 104,084,956 (GRCm39) S85P probably benign Het
Use1 G A 8: 71,819,942 (GRCm39) V36I probably benign Het
Vmn2r13 T A 5: 109,304,242 (GRCm39) T730S possibly damaging Het
Vmn2r9 T C 5: 108,992,923 (GRCm39) D529G possibly damaging Het
Washc5 A G 15: 59,217,233 (GRCm39) I778T possibly damaging Het
Washc5 A T 15: 59,233,069 (GRCm39) M294K probably damaging Het
Wnt8a A T 18: 34,680,298 (GRCm39) D221V probably damaging Het
Zfp616 A G 11: 73,976,539 (GRCm39) K936R probably damaging Het
Zfp618 G A 4: 63,012,687 (GRCm39) C133Y probably damaging Het
Zfp82 A G 7: 29,761,714 (GRCm39) S56P probably damaging Het
Zkscan16 T A 4: 58,957,021 (GRCm39) D434E probably benign Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9027:Vmn1r228 UTSW 17 20,997,422 (GRCm39) missense probably benign 0.01
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGAAAACACAAAGCTATGATTGCTG -3'
(R):5'- ACAAAGTTTATGGGCCTGTCC -3'

Sequencing Primer
(F):5'- GATTGCTGTTATATTCATTACCCACC -3'
(R):5'- ACAAAGTTTATGGGCCTGTCCATTTC -3'
Posted On 2021-10-11