Mutagenetix > Incidental Mutation

Incidental Mutation 'R9023:Atp6v0a2'

686350

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R9023 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124719074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 734 (T734M)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037865
AA Change: T734M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: T734M

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,659,958	D760G	possibly damaging	Het
Adamts14	C	T	10: 61,203,001	S907N	probably damaging	Het
Adgrf1	A	T	17: 43,303,760	Y245F	possibly damaging	Het
Adgrl3	C	T	5: 81,465,218	A98V	probably damaging	Het
Afmid	A	T	11: 117,835,523	I186F	probably damaging	Het
Ago4	A	G	4: 126,506,803	Y706H	probably damaging	Het
Appl1	A	T	14: 26,963,695	S55R	possibly damaging	Het
Ash1l	A	G	3: 88,985,269	H1485R	probably damaging	Het
B3gat1	T	C	9: 26,751,773		probably benign	Het
BC055324	A	T	1: 163,990,731	I47N	possibly damaging	Het
Bcl7c	T	C	7: 127,707,332	N96D	probably benign	Het
Brca2	T	C	5: 150,541,895	L1708P	probably benign	Het
Ccl8	C	T	11: 82,116,047	P29S	possibly damaging	Het
Clpx	T	A	9: 65,326,833	C587S	probably null	Het
Coro2b	T	C	9: 62,425,696	D168G		Het
Dst	T	C	1: 34,114,024		probably null	Het
Eps8l1	C	T	7: 4,474,043	Q443*	probably null	Het
Fam131b	G	T	6: 42,322,012	N11K	possibly damaging	Het
Fry	T	C	5: 150,437,303	V125A	probably benign	Het
Ftcd	T	C	10: 76,581,579	F284S	probably damaging	Het
Glg1	A	G	8: 111,177,748	I617T	probably damaging	Het
Gm37596	A	G	3: 93,692,435	F209S	probably damaging	Het
Gm4847	C	T	1: 166,641,763	V111M	probably damaging	Het
Hcrtr2	C	T	9: 76,254,572	V179I	probably damaging	Het
Herc6	A	G	6: 57,618,627	N430S	probably benign	Het
Kdelc1	T	C	1: 44,114,765	I175V	possibly damaging	Het
Knl1	T	C	2: 119,070,280	S821P	probably benign	Het
Letm2	C	T	8: 25,587,220	V285I		Het
Map3k14	T	C	11: 103,239,009	T361A	possibly damaging	Het
Mmp10	A	T	9: 7,504,912	M236L	probably damaging	Het
Mmp16	A	G	4: 17,996,202	K97R	probably benign	Het
Muc6	T	A	7: 141,651,167	K194*	probably null	Het
Myo18a	A	G	11: 77,827,651	Y949C	probably damaging	Het
Nat8f1	A	G	6: 85,910,387	L197P	probably damaging	Het
Nlrp9a	T	G	7: 26,573,866	N976K	possibly damaging	Het
Olfr223	A	T	11: 59,589,541	C183S	probably damaging	Het
Olfr657	C	T	7: 104,636,084	R137C	probably benign	Het
Olfr938	T	C	9: 39,078,011	I245V	probably benign	Het
Parp3	T	C	9: 106,471,291	Y515C	probably damaging	Het
Pde11a	C	G	2: 76,136,459	A549P	probably damaging	Het
Pdlim4	T	C	11: 54,068,836		probably benign	Het
Pla2g4e	T	C	2: 120,171,237	T644A	probably benign	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Prpmp5	GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT	G	6: 132,312,211		probably null	Het
Prr7	A	G	13: 55,472,421	S133G	possibly damaging	Het
Pten	C	A	19: 32,818,012	D326E	possibly damaging	Het
Ranbp2	T	A	10: 58,479,521	L2021*	probably null	Het
Rassf5	T	C	1: 131,212,340	I161V	probably benign	Het
Ric1	C	A	19: 29,570,743		probably benign	Het
Samd9l	A	G	6: 3,373,791	S1157P	probably damaging	Het
Serpinb1a	A	G	13: 32,845,780	V153A	probably damaging	Het
Shank1	T	C	7: 44,319,107	Y275H	unknown	Het
Slc6a18	C	T	13: 73,675,770	G84R	probably damaging	Het
Smarcc2	A	G	10: 128,465,224	E187G	probably damaging	Het
Stxbp4	A	G	11: 90,535,423	S520P	unknown	Het
Taar8b	C	T	10: 24,091,307	E330K	probably benign	Het
Tex14	T	A	11: 87,474,413	V61D		Het
Tg	T	C	15: 66,683,673	F738S	probably damaging	Het
Trpc4	T	C	3: 54,194,833	S51P	possibly damaging	Het
Ttn	T	C	2: 76,795,887	S14975G	probably benign	Het
Usp15	C	T	10: 123,125,593	G685R	possibly damaging	Het
Usp17lc	C	T	7: 103,418,332	P278L	possibly damaging	Het
Wasf1	T	C	10: 40,934,575	V271A	possibly damaging	Het
Zbtb46	C	T	2: 181,424,142	V72I	possibly damaging	Het
Zfp462	A	G	4: 55,007,563	M1V	probably null	Het
Zfp648	T	C	1: 154,205,168	F358L	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGTCCTCATGGCAATCGG -3'
(R):5'- AGGACTGCAACCTGTACAATC -3'

Sequencing Primer
(F):5'- TCATGGCAATCGGAGCTTCAG -3'
(R):5'- CTGCAACCTGTACAATCAGAATGTGG -3'

Posted On

2021-10-11