Incidental Mutation 'R9023:Olfr938'
ID 686370
Institutional Source Beutler Lab
Gene Symbol Olfr938
Ensembl Gene ENSMUSG00000048501
Gene Name olfactory receptor 938
Synonyms GA_x6K02T2PVTD-32774646-32773699, MOR171-25
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9023 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39077698-39078887 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39078011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 245 (I245V)
Ref Sequence ENSEMBL: ENSMUSP00000055053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056499]
AlphaFold Q9EQ93
Predicted Effect probably benign
Transcript: ENSMUST00000056499
AA Change: I245V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055053
Gene: ENSMUSG00000048501
AA Change: I245V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-49 PFAM
Pfam:7tm_1 41 290 5.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,659,958 D760G possibly damaging Het
Adamts14 C T 10: 61,203,001 S907N probably damaging Het
Adgrf1 A T 17: 43,303,760 Y245F possibly damaging Het
Adgrl3 C T 5: 81,465,218 A98V probably damaging Het
Afmid A T 11: 117,835,523 I186F probably damaging Het
Ago4 A G 4: 126,506,803 Y706H probably damaging Het
Appl1 A T 14: 26,963,695 S55R possibly damaging Het
Ash1l A G 3: 88,985,269 H1485R probably damaging Het
Atp6v0a2 C T 5: 124,719,074 T734M possibly damaging Het
B3gat1 T C 9: 26,751,773 probably benign Het
BC055324 A T 1: 163,990,731 I47N possibly damaging Het
Bcl7c T C 7: 127,707,332 N96D probably benign Het
Brca2 T C 5: 150,541,895 L1708P probably benign Het
Ccl8 C T 11: 82,116,047 P29S possibly damaging Het
Clpx T A 9: 65,326,833 C587S probably null Het
Coro2b T C 9: 62,425,696 D168G Het
Dst T C 1: 34,114,024 probably null Het
Eps8l1 C T 7: 4,474,043 Q443* probably null Het
Fam131b G T 6: 42,322,012 N11K possibly damaging Het
Fry T C 5: 150,437,303 V125A probably benign Het
Ftcd T C 10: 76,581,579 F284S probably damaging Het
Glg1 A G 8: 111,177,748 I617T probably damaging Het
Gm37596 A G 3: 93,692,435 F209S probably damaging Het
Gm4847 C T 1: 166,641,763 V111M probably damaging Het
Hcrtr2 C T 9: 76,254,572 V179I probably damaging Het
Herc6 A G 6: 57,618,627 N430S probably benign Het
Kdelc1 T C 1: 44,114,765 I175V possibly damaging Het
Knl1 T C 2: 119,070,280 S821P probably benign Het
Letm2 C T 8: 25,587,220 V285I Het
Map3k14 T C 11: 103,239,009 T361A possibly damaging Het
Mmp10 A T 9: 7,504,912 M236L probably damaging Het
Mmp16 A G 4: 17,996,202 K97R probably benign Het
Muc6 T A 7: 141,651,167 K194* probably null Het
Myo18a A G 11: 77,827,651 Y949C probably damaging Het
Nat8f1 A G 6: 85,910,387 L197P probably damaging Het
Nlrp9a T G 7: 26,573,866 N976K possibly damaging Het
Olfr223 A T 11: 59,589,541 C183S probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Parp3 T C 9: 106,471,291 Y515C probably damaging Het
Pde11a C G 2: 76,136,459 A549P probably damaging Het
Pdlim4 T C 11: 54,068,836 probably benign Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Prpmp5 GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT G 6: 132,312,211 probably null Het
Prr7 A G 13: 55,472,421 S133G possibly damaging Het
Pten C A 19: 32,818,012 D326E possibly damaging Het
Ranbp2 T A 10: 58,479,521 L2021* probably null Het
Rassf5 T C 1: 131,212,340 I161V probably benign Het
Ric1 C A 19: 29,570,743 probably benign Het
Samd9l A G 6: 3,373,791 S1157P probably damaging Het
Serpinb1a A G 13: 32,845,780 V153A probably damaging Het
Shank1 T C 7: 44,319,107 Y275H unknown Het
Slc6a18 C T 13: 73,675,770 G84R probably damaging Het
Smarcc2 A G 10: 128,465,224 E187G probably damaging Het
Stxbp4 A G 11: 90,535,423 S520P unknown Het
Taar8b C T 10: 24,091,307 E330K probably benign Het
Tex14 T A 11: 87,474,413 V61D Het
Tg T C 15: 66,683,673 F738S probably damaging Het
Trpc4 T C 3: 54,194,833 S51P possibly damaging Het
Ttn T C 2: 76,795,887 S14975G probably benign Het
Usp15 C T 10: 123,125,593 G685R possibly damaging Het
Usp17lc C T 7: 103,418,332 P278L possibly damaging Het
Wasf1 T C 10: 40,934,575 V271A possibly damaging Het
Zbtb46 C T 2: 181,424,142 V72I possibly damaging Het
Zfp462 A G 4: 55,007,563 M1V probably null Het
Zfp648 T C 1: 154,205,168 F358L probably damaging Het
Other mutations in Olfr938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr938 APN 9 39078451 missense probably damaging 0.96
IGL01298:Olfr938 APN 9 39078724 missense possibly damaging 0.63
IGL02930:Olfr938 APN 9 39078012 missense probably damaging 1.00
IGL03346:Olfr938 APN 9 39077962 missense probably damaging 0.99
IGL03346:Olfr938 APN 9 39077961 missense probably benign 0.35
IGL03399:Olfr938 APN 9 39078237 nonsense probably null
R0536:Olfr938 UTSW 9 39078329 missense probably benign 0.03
R1170:Olfr938 UTSW 9 39078229 missense possibly damaging 0.50
R1951:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R1952:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R2066:Olfr938 UTSW 9 39078214 missense probably damaging 1.00
R2906:Olfr938 UTSW 9 39078373 missense probably benign 0.39
R4707:Olfr938 UTSW 9 39078262 missense probably benign 0.00
R4767:Olfr938 UTSW 9 39078692 missense possibly damaging 0.71
R4951:Olfr938 UTSW 9 39078259 missense probably benign 0.10
R5888:Olfr938 UTSW 9 39077967 nonsense probably null
R5905:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6028:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6329:Olfr938 UTSW 9 39077903 missense probably benign 0.02
R7240:Olfr938 UTSW 9 39078610 missense probably damaging 0.99
R7345:Olfr938 UTSW 9 39078334 missense probably damaging 1.00
R8058:Olfr938 UTSW 9 39078566 missense probably damaging 1.00
R9547:Olfr938 UTSW 9 39078631 missense probably damaging 0.99
X0062:Olfr938 UTSW 9 39078466 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCATGAACTCTGGTTTCATTG -3'
(R):5'- CCATTACTGGAGCTCTCGTG -3'

Sequencing Primer
(F):5'- CACACATAGAGTTATTAATGGCTGC -3'
(R):5'- TTGTACCAGCTCTGACCA -3'
Posted On 2021-10-11