Incidental Mutation 'R9023:Or8g24'
ID 686370
Institutional Source Beutler Lab
Gene Symbol Or8g24
Ensembl Gene ENSMUSG00000048501
Gene Name olfactory receptor family 8 subfamily G member 24
Synonyms MOR171-25, Olfr938, GA_x6K02T2PVTD-32774646-32773699
MMRRC Submission 068853-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9023 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 38989092-38990039 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38989307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 245 (I245V)
Ref Sequence ENSEMBL: ENSMUSP00000055053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056499]
AlphaFold Q9EQ93
Predicted Effect probably benign
Transcript: ENSMUST00000056499
AA Change: I245V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055053
Gene: ENSMUSG00000048501
AA Change: I245V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-49 PFAM
Pfam:7tm_1 41 290 5.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,636,917 (GRCm39) D760G possibly damaging Het
Adamts14 C T 10: 61,038,780 (GRCm39) S907N probably damaging Het
Adgrf1 A T 17: 43,614,651 (GRCm39) Y245F possibly damaging Het
Adgrl3 C T 5: 81,613,065 (GRCm39) A98V probably damaging Het
Afmid A T 11: 117,726,349 (GRCm39) I186F probably damaging Het
Ago4 A G 4: 126,400,596 (GRCm39) Y706H probably damaging Het
Appl1 A T 14: 26,685,652 (GRCm39) S55R possibly damaging Het
Ash1l A G 3: 88,892,576 (GRCm39) H1485R probably damaging Het
Atp6v0a2 C T 5: 124,796,138 (GRCm39) T734M possibly damaging Het
B3gat1 T C 9: 26,663,069 (GRCm39) probably benign Het
Bcl7c T C 7: 127,306,504 (GRCm39) N96D probably benign Het
Brca2 T C 5: 150,465,360 (GRCm39) L1708P probably benign Het
Ccl8 C T 11: 82,006,873 (GRCm39) P29S possibly damaging Het
Clpx T A 9: 65,234,115 (GRCm39) C587S probably null Het
Coro2b T C 9: 62,332,978 (GRCm39) D168G Het
Dst T C 1: 34,153,105 (GRCm39) probably null Het
Eps8l1 C T 7: 4,477,042 (GRCm39) Q443* probably null Het
Fam131b G T 6: 42,298,946 (GRCm39) N11K possibly damaging Het
Firrm A T 1: 163,818,300 (GRCm39) I47N possibly damaging Het
Fry T C 5: 150,360,768 (GRCm39) V125A probably benign Het
Ftcd T C 10: 76,417,413 (GRCm39) F284S probably damaging Het
Glg1 A G 8: 111,904,380 (GRCm39) I617T probably damaging Het
Gm4847 C T 1: 166,469,332 (GRCm39) V111M probably damaging Het
Hcrtr2 C T 9: 76,161,854 (GRCm39) V179I probably damaging Het
Herc6 A G 6: 57,595,612 (GRCm39) N430S probably benign Het
Knl1 T C 2: 118,900,761 (GRCm39) S821P probably benign Het
Letm2 C T 8: 26,077,236 (GRCm39) V285I Het
Map3k14 T C 11: 103,129,835 (GRCm39) T361A possibly damaging Het
Mmp10 A T 9: 7,504,913 (GRCm39) M236L probably damaging Het
Mmp16 A G 4: 17,996,202 (GRCm39) K97R probably benign Het
Muc6 T A 7: 141,237,432 (GRCm39) K194* probably null Het
Myo18a A G 11: 77,718,477 (GRCm39) Y949C probably damaging Het
Nat8f1 A G 6: 85,887,369 (GRCm39) L197P probably damaging Het
Nlrp9a T G 7: 26,273,291 (GRCm39) N976K possibly damaging Het
Or2aa1 A T 11: 59,480,367 (GRCm39) C183S probably damaging Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Parp3 T C 9: 106,348,490 (GRCm39) Y515C probably damaging Het
Pde11a C G 2: 75,966,803 (GRCm39) A549P probably damaging Het
Pdlim4 T C 11: 53,959,662 (GRCm39) probably benign Het
Pla2g4e T C 2: 120,001,718 (GRCm39) T644A probably benign Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Poglut2 T C 1: 44,153,925 (GRCm39) I175V possibly damaging Het
Prb1b GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT G 6: 132,289,174 (GRCm39) probably null Het
Prr7 A G 13: 55,620,234 (GRCm39) S133G possibly damaging Het
Pten C A 19: 32,795,412 (GRCm39) D326E possibly damaging Het
Ranbp2 T A 10: 58,315,343 (GRCm39) L2021* probably null Het
Rassf5 T C 1: 131,140,077 (GRCm39) I161V probably benign Het
Ric1 C A 19: 29,548,143 (GRCm39) probably benign Het
Samd9l A G 6: 3,373,791 (GRCm39) S1157P probably damaging Het
Serpinb1a A G 13: 33,029,763 (GRCm39) V153A probably damaging Het
Shank1 T C 7: 43,968,531 (GRCm39) Y275H unknown Het
Slc6a18 C T 13: 73,823,889 (GRCm39) G84R probably damaging Het
Smarcc2 A G 10: 128,301,093 (GRCm39) E187G probably damaging Het
Stxbp4 A G 11: 90,426,249 (GRCm39) S520P unknown Het
Taar8b C T 10: 23,967,205 (GRCm39) E330K probably benign Het
Tdpoz6 A G 3: 93,599,742 (GRCm39) F209S probably damaging Het
Tex14 T A 11: 87,365,239 (GRCm39) V61D Het
Tg T C 15: 66,555,522 (GRCm39) F738S probably damaging Het
Trpc4 T C 3: 54,102,254 (GRCm39) S51P possibly damaging Het
Ttn T C 2: 76,626,231 (GRCm39) S14975G probably benign Het
Usp15 C T 10: 122,961,498 (GRCm39) G685R possibly damaging Het
Usp17lc C T 7: 103,067,539 (GRCm39) P278L possibly damaging Het
Wasf1 T C 10: 40,810,571 (GRCm39) V271A possibly damaging Het
Zbtb46 C T 2: 181,065,935 (GRCm39) V72I possibly damaging Het
Zfp462 A G 4: 55,007,563 (GRCm39) M1V probably null Het
Zfp648 T C 1: 154,080,914 (GRCm39) F358L probably damaging Het
Other mutations in Or8g24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Or8g24 APN 9 38,989,747 (GRCm39) missense probably damaging 0.96
IGL01298:Or8g24 APN 9 38,990,020 (GRCm39) missense possibly damaging 0.63
IGL02930:Or8g24 APN 9 38,989,308 (GRCm39) missense probably damaging 1.00
IGL03346:Or8g24 APN 9 38,989,257 (GRCm39) missense probably benign 0.35
IGL03346:Or8g24 APN 9 38,989,258 (GRCm39) missense probably damaging 0.99
IGL03399:Or8g24 APN 9 38,989,533 (GRCm39) nonsense probably null
R0536:Or8g24 UTSW 9 38,989,625 (GRCm39) missense probably benign 0.03
R1170:Or8g24 UTSW 9 38,989,525 (GRCm39) missense possibly damaging 0.50
R1951:Or8g24 UTSW 9 38,989,580 (GRCm39) missense probably benign 0.07
R1952:Or8g24 UTSW 9 38,989,580 (GRCm39) missense probably benign 0.07
R2066:Or8g24 UTSW 9 38,989,510 (GRCm39) missense probably damaging 1.00
R2906:Or8g24 UTSW 9 38,989,669 (GRCm39) missense probably benign 0.39
R4707:Or8g24 UTSW 9 38,989,558 (GRCm39) missense probably benign 0.00
R4767:Or8g24 UTSW 9 38,989,988 (GRCm39) missense possibly damaging 0.71
R4951:Or8g24 UTSW 9 38,989,555 (GRCm39) missense probably benign 0.10
R5888:Or8g24 UTSW 9 38,989,263 (GRCm39) nonsense probably null
R5905:Or8g24 UTSW 9 38,989,379 (GRCm39) missense probably damaging 1.00
R6028:Or8g24 UTSW 9 38,989,379 (GRCm39) missense probably damaging 1.00
R6329:Or8g24 UTSW 9 38,989,199 (GRCm39) missense probably benign 0.02
R7240:Or8g24 UTSW 9 38,989,906 (GRCm39) missense probably damaging 0.99
R7345:Or8g24 UTSW 9 38,989,630 (GRCm39) missense probably damaging 1.00
R8058:Or8g24 UTSW 9 38,989,862 (GRCm39) missense probably damaging 1.00
R9547:Or8g24 UTSW 9 38,989,927 (GRCm39) missense probably damaging 0.99
R9682:Or8g24 UTSW 9 38,989,874 (GRCm39) missense possibly damaging 0.95
R9760:Or8g24 UTSW 9 38,989,271 (GRCm39) missense possibly damaging 0.95
X0062:Or8g24 UTSW 9 38,989,762 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCATGAACTCTGGTTTCATTG -3'
(R):5'- CCATTACTGGAGCTCTCGTG -3'

Sequencing Primer
(F):5'- CACACATAGAGTTATTAATGGCTGC -3'
(R):5'- TTGTACCAGCTCTGACCA -3'
Posted On 2021-10-11