Incidental Mutation 'R9023:Appl1'
ID 686392
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R9023 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26918988-26971232 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26963695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 55 (S55R)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect possibly damaging
Transcript: ENSMUST00000036570
AA Change: S55R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: S55R

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,659,958 D760G possibly damaging Het
Adamts14 C T 10: 61,203,001 S907N probably damaging Het
Adgrf1 A T 17: 43,303,760 Y245F possibly damaging Het
Adgrl3 C T 5: 81,465,218 A98V probably damaging Het
Afmid A T 11: 117,835,523 I186F probably damaging Het
Ago4 A G 4: 126,506,803 Y706H probably damaging Het
Ash1l A G 3: 88,985,269 H1485R probably damaging Het
Atp6v0a2 C T 5: 124,719,074 T734M possibly damaging Het
B3gat1 T C 9: 26,751,773 probably benign Het
BC055324 A T 1: 163,990,731 I47N possibly damaging Het
Bcl7c T C 7: 127,707,332 N96D probably benign Het
Brca2 T C 5: 150,541,895 L1708P probably benign Het
Ccl8 C T 11: 82,116,047 P29S possibly damaging Het
Clpx T A 9: 65,326,833 C587S probably null Het
Coro2b T C 9: 62,425,696 D168G Het
Dst T C 1: 34,114,024 probably null Het
Eps8l1 C T 7: 4,474,043 Q443* probably null Het
Fam131b G T 6: 42,322,012 N11K possibly damaging Het
Fry T C 5: 150,437,303 V125A probably benign Het
Ftcd T C 10: 76,581,579 F284S probably damaging Het
Glg1 A G 8: 111,177,748 I617T probably damaging Het
Gm37596 A G 3: 93,692,435 F209S probably damaging Het
Gm4847 C T 1: 166,641,763 V111M probably damaging Het
Hcrtr2 C T 9: 76,254,572 V179I probably damaging Het
Herc6 A G 6: 57,618,627 N430S probably benign Het
Kdelc1 T C 1: 44,114,765 I175V possibly damaging Het
Knl1 T C 2: 119,070,280 S821P probably benign Het
Letm2 C T 8: 25,587,220 V285I Het
Map3k14 T C 11: 103,239,009 T361A possibly damaging Het
Mmp10 A T 9: 7,504,912 M236L probably damaging Het
Mmp16 A G 4: 17,996,202 K97R probably benign Het
Muc6 T A 7: 141,651,167 K194* probably null Het
Myo18a A G 11: 77,827,651 Y949C probably damaging Het
Nat8f1 A G 6: 85,910,387 L197P probably damaging Het
Nlrp9a T G 7: 26,573,866 N976K possibly damaging Het
Olfr223 A T 11: 59,589,541 C183S probably damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr938 T C 9: 39,078,011 I245V probably benign Het
Parp3 T C 9: 106,471,291 Y515C probably damaging Het
Pde11a C G 2: 76,136,459 A549P probably damaging Het
Pdlim4 T C 11: 54,068,836 probably benign Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Prpmp5 GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT G 6: 132,312,211 probably null Het
Prr7 A G 13: 55,472,421 S133G possibly damaging Het
Pten C A 19: 32,818,012 D326E possibly damaging Het
Ranbp2 T A 10: 58,479,521 L2021* probably null Het
Rassf5 T C 1: 131,212,340 I161V probably benign Het
Ric1 C A 19: 29,570,743 probably benign Het
Samd9l A G 6: 3,373,791 S1157P probably damaging Het
Serpinb1a A G 13: 32,845,780 V153A probably damaging Het
Shank1 T C 7: 44,319,107 Y275H unknown Het
Slc6a18 C T 13: 73,675,770 G84R probably damaging Het
Smarcc2 A G 10: 128,465,224 E187G probably damaging Het
Stxbp4 A G 11: 90,535,423 S520P unknown Het
Taar8b C T 10: 24,091,307 E330K probably benign Het
Tex14 T A 11: 87,474,413 V61D Het
Tg T C 15: 66,683,673 F738S probably damaging Het
Trpc4 T C 3: 54,194,833 S51P possibly damaging Het
Ttn T C 2: 76,795,887 S14975G probably benign Het
Usp15 C T 10: 123,125,593 G685R possibly damaging Het
Usp17lc C T 7: 103,418,332 P278L possibly damaging Het
Wasf1 T C 10: 40,934,575 V271A possibly damaging Het
Zbtb46 C T 2: 181,424,142 V72I possibly damaging Het
Zfp462 A G 4: 55,007,563 M1V probably null Het
Zfp648 T C 1: 154,205,168 F358L probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R7943:Appl1 UTSW 14 26945568 missense probably benign 0.01
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
R8379:Appl1 UTSW 14 26925415 critical splice donor site probably null
R8464:Appl1 UTSW 14 26953028 nonsense probably null
R8699:Appl1 UTSW 14 26940255 missense probably benign
R9090:Appl1 UTSW 14 26947127 missense probably benign 0.01
R9203:Appl1 UTSW 14 26961013 nonsense probably null
R9227:Appl1 UTSW 14 26923735 missense unknown
R9230:Appl1 UTSW 14 26923735 missense unknown
R9243:Appl1 UTSW 14 26927753 missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26947127 missense probably benign 0.01
R9378:Appl1 UTSW 14 26927827 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCATGCTGAGATCCATGC -3'
(R):5'- TGCCCATGTTCTCTAGATTGAAG -3'

Sequencing Primer
(F):5'- TGCTGAGATCCATGCTCTAAAAC -3'
(R):5'- TTTAGTTTTCATTAGCAGAGACTCTC -3'
Posted On 2021-10-11