Incidental Mutation 'R9024:Chfr'
ID 686416
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R9024 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110158832 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 481 (S481I)
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]
AlphaFold Q810L3
Predicted Effect probably benign
Transcript: ENSMUST00000014812
AA Change: S480I

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: S480I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112519
AA Change: S481I

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: S481I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect possibly damaging
Transcript: ENSMUST00000198633
AA Change: S409I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: S409I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000199672
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C A 3: 138,186,162 A16S unknown Het
Aldh3b1 T A 19: 3,918,155 I335F probably damaging Het
Asph A T 4: 9,475,025 Y650N probably damaging Het
Atr T C 9: 95,907,363 V1524A possibly damaging Het
Ccin A G 4: 43,983,562 probably benign Het
Cdk15 A T 1: 59,287,798 I213F probably damaging Het
Coro2a T C 4: 46,542,323 D350G probably benign Het
Ctps C A 4: 120,549,510 E350* probably null Het
Dctn4 G A 18: 60,545,822 probably null Het
Epha4 C A 1: 77,388,532 R610L possibly damaging Het
Esp4 A T 17: 40,600,211 M1L unknown Het
Fads3 T C 19: 10,056,475 V408A probably damaging Het
Gm19402 T A 10: 77,689,971 K263* probably null Het
Gm26657 G T 4: 56,740,769 probably benign Het
Hsdl1 A G 8: 119,564,100 V311A probably benign Het
Hsp90b1 A G 10: 86,705,310 F16L possibly damaging Het
Icmt T C 4: 152,300,704 C208R probably damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ipo7 T A 7: 110,044,736 probably null Het
Kif21a T A 15: 90,937,196 K1465* probably null Het
Klhl9 A T 4: 88,721,762 F81I probably damaging Het
Kynu A G 2: 43,600,795 H170R possibly damaging Het
Mmp12 A G 9: 7,355,444 Y397C probably damaging Het
Mpped2 T C 2: 106,783,698 F126L probably benign Het
Muc2 C T 7: 141,701,367 P236S probably damaging Het
Myo10 A G 15: 25,793,209 T1291A possibly damaging Het
Myom2 T C 8: 15,063,936 L28P probably damaging Het
Nfatc2 T C 2: 168,486,728 *924W probably null Het
Nrip1 G T 16: 76,291,500 Y1056* probably null Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Oxr1 A G 15: 41,831,122 Y20C probably damaging Het
P2ry2 T C 7: 100,998,022 T359A probably damaging Het
Paxbp1 G A 16: 91,044,075 R94C possibly damaging Het
Pbrm1 A G 14: 31,061,666 Y569C probably damaging Het
Pkhd1 T C 1: 20,522,751 T1713A probably benign Het
Plekha5 A G 6: 140,424,450 S56G probably benign Het
Plekhg5 T C 4: 152,112,661 I801T possibly damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pogz A T 3: 94,878,232 N833Y probably damaging Het
Polk G T 13: 96,486,832 H501N probably benign Het
Ptprd T C 4: 75,956,330 N1043S probably damaging Het
Rad18 A T 6: 112,649,601 C448S probably benign Het
Rhof T A 5: 123,131,900 K65* probably null Het
Rpa2 T C 4: 132,771,842 V74A probably damaging Het
Smarcc1 T C 9: 110,185,933 M522T probably damaging Het
Snai2 T C 16: 14,706,905 S92P probably benign Het
Srrt C A 5: 137,303,029 R45L unknown Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tubd1 T G 11: 86,555,165 H210Q possibly damaging Het
Usp36 T C 11: 118,276,157 N298S possibly damaging Het
Vmn2r63 T G 7: 42,928,450 R221S probably benign Het
Vps13b A G 15: 35,923,324 I3782V probably damaging Het
Zfp184 T A 13: 21,958,958 I278N probably damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9419:Chfr UTSW 5 110169190 missense probably damaging 1.00
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGGCCTGAATTCTTGTG -3'
(R):5'- TCAGCTACGTCTCTATCCAAAG -3'

Sequencing Primer
(F):5'- GCAGAATATCATTTGGCCACTTAGG -3'
(R):5'- CTCTATCCAAAGACCTCTTTTAATGG -3'
Posted On 2021-10-11