Incidental Mutation 'R9024:Usp36'
ID 686435
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R9024 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118166983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 298 (N298S)
Ref Sequence ENSEMBL: ENSMUSP00000101903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000092382
AA Change: N298S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: N298S

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106296
AA Change: N298S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: N298S

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144153
AA Change: N133S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909
AA Change: N133S

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C A 3: 137,891,923 (GRCm39) A16S unknown Het
Aldh3b1 T A 19: 3,968,155 (GRCm39) I335F probably damaging Het
Asph A T 4: 9,475,025 (GRCm39) Y650N probably damaging Het
Atr T C 9: 95,789,416 (GRCm39) V1524A possibly damaging Het
Ccin A G 4: 43,983,562 (GRCm39) probably benign Het
Cdk15 A T 1: 59,326,957 (GRCm39) I213F probably damaging Het
Chfr G T 5: 110,306,698 (GRCm39) S481I probably benign Het
Coro2a T C 4: 46,542,323 (GRCm39) D350G probably benign Het
Ctps1 C A 4: 120,406,707 (GRCm39) E350* probably null Het
Dctn4 G A 18: 60,678,894 (GRCm39) probably null Het
Epha4 C A 1: 77,365,169 (GRCm39) R610L possibly damaging Het
Esp4 A T 17: 40,911,102 (GRCm39) M1L unknown Het
Fads3 T C 19: 10,033,839 (GRCm39) V408A probably damaging Het
Gm19402 T A 10: 77,525,805 (GRCm39) K263* probably null Het
Gm26657 G T 4: 56,740,769 (GRCm39) probably benign Het
Hsdl1 A G 8: 120,290,839 (GRCm39) V311A probably benign Het
Hsp90b1 A G 10: 86,541,174 (GRCm39) F16L possibly damaging Het
Icmt T C 4: 152,385,161 (GRCm39) C208R probably damaging Het
Il18rap C T 1: 40,582,177 (GRCm39) T366M probably benign Het
Ipo7 T A 7: 109,643,943 (GRCm39) probably null Het
Kif21a T A 15: 90,821,399 (GRCm39) K1465* probably null Het
Klhl9 A T 4: 88,639,999 (GRCm39) F81I probably damaging Het
Kynu A G 2: 43,490,807 (GRCm39) H170R possibly damaging Het
Mmp12 A G 9: 7,355,444 (GRCm39) Y397C probably damaging Het
Mpped2 T C 2: 106,614,043 (GRCm39) F126L probably benign Het
Muc2 C T 7: 141,287,936 (GRCm39) P236S probably damaging Het
Myo10 A G 15: 25,793,295 (GRCm39) T1291A possibly damaging Het
Myom2 T C 8: 15,113,936 (GRCm39) L28P probably damaging Het
Nfatc2 T C 2: 168,328,648 (GRCm39) *924W probably null Het
Nrip1 G T 16: 76,088,388 (GRCm39) Y1056* probably null Het
Or56b1 C T 7: 104,285,291 (GRCm39) R137C probably benign Het
Oxr1 A G 15: 41,694,518 (GRCm39) Y20C probably damaging Het
P2ry2 T C 7: 100,647,229 (GRCm39) T359A probably damaging Het
Paxbp1 G A 16: 90,840,963 (GRCm39) R94C possibly damaging Het
Pbrm1 A G 14: 30,783,623 (GRCm39) Y569C probably damaging Het
Pkhd1 T C 1: 20,592,975 (GRCm39) T1713A probably benign Het
Plekha5 A G 6: 140,370,176 (GRCm39) S56G probably benign Het
Plekhg5 T C 4: 152,197,118 (GRCm39) I801T possibly damaging Het
Pmm1 C T 15: 81,839,896 (GRCm39) R143H probably damaging Het
Pogz A T 3: 94,785,543 (GRCm39) N833Y probably damaging Het
Polk G T 13: 96,623,340 (GRCm39) H501N probably benign Het
Ptprd T C 4: 75,874,567 (GRCm39) N1043S probably damaging Het
Rad18 A T 6: 112,626,562 (GRCm39) C448S probably benign Het
Rhof T A 5: 123,269,963 (GRCm39) K65* probably null Het
Rpa2 T C 4: 132,499,153 (GRCm39) V74A probably damaging Het
Smarcc1 T C 9: 110,015,001 (GRCm39) M522T probably damaging Het
Snai2 T C 16: 14,524,769 (GRCm39) S92P probably benign Het
Srrt C A 5: 137,301,291 (GRCm39) R45L unknown Het
Tmem233 T C 5: 116,221,057 (GRCm39) Y63C probably damaging Het
Tubd1 T G 11: 86,445,991 (GRCm39) H210Q possibly damaging Het
Vmn2r63 T G 7: 42,577,874 (GRCm39) R221S probably benign Het
Vps13b A G 15: 35,923,470 (GRCm39) I3782V probably damaging Het
Zfp184 T A 13: 22,143,128 (GRCm39) I278N probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R7843:Usp36 UTSW 11 118,176,791 (GRCm39) missense probably damaging 1.00
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACACCCTGCTCCTTATG -3'
(R):5'- AGGCCGGGTTTTAAGCAAG -3'

Sequencing Primer
(F):5'- TTATGCACAGCCTTCGACAAG -3'
(R):5'- CCGGGTTTTAAGCAAGTCAGG -3'
Posted On 2021-10-11