Incidental Mutation 'R9025:Scarb1'
ID 686465
Institutional Source Beutler Lab
Gene Symbol Scarb1
Ensembl Gene ENSMUSG00000037936
Gene Name scavenger receptor class B, member 1
Synonyms Cd36l1, Srb1, Hdlq1, SRBI, Hlb398, Cla-1, SR-BI, D5Ertd460e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9025 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 125277087-125341094 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125304350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 43 (N43K)
Ref Sequence ENSEMBL: ENSMUSP00000083242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086075] [ENSMUST00000111390] [ENSMUST00000137783]
AlphaFold Q61009
PDB Structure Molecular analysis of the interaction of the HDL-receptor SR-BI with the PDZ3 domain of its adaptor protein PDZK1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000086075
AA Change: N43K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083242
Gene: ENSMUSG00000037936
AA Change: N43K

DomainStartEndE-ValueType
Pfam:CD36 16 463 6.4e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111390
AA Change: N43K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107021
Gene: ENSMUSG00000037936
AA Change: N43K

DomainStartEndE-ValueType
Pfam:CD36 14 465 4.7e-158 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137783
AA Change: C32S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Targeted mutations result in abnormal lipoprotein metablolism and, for one allele, reversible female infertility. An ENU mutant shows increased cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,557,582 N837K possibly damaging Het
Adam29 A T 8: 55,872,161 C419* probably null Het
Adamts7 C A 9: 90,185,795 S446* probably null Het
Ager A G 17: 34,600,620 R371G probably damaging Het
Apobr T A 7: 126,586,457 V380E possibly damaging Het
Arhgap26 T C 18: 39,246,845 S105P Het
Atrip A G 9: 109,073,838 F56S probably damaging Het
Bag2 T C 1: 33,746,824 Y139C Het
Bccip C T 7: 133,717,617 Q146* probably null Het
Btbd10 G A 7: 113,351,824 R20W possibly damaging Het
Catsperd T A 17: 56,655,156 N443K probably damaging Het
Cdh26 G A 2: 178,462,616 E265K probably benign Het
Cep76 T C 18: 67,634,815 R216G probably damaging Het
Cnot1 T A 8: 95,749,032 M1000L probably benign Het
Cyp1a1 A G 9: 57,702,787 T495A possibly damaging Het
Cyp2w1 T A 5: 139,356,715 M421K probably benign Het
Dlg5 T C 14: 24,149,478 T1453A probably benign Het
Dnah5 G T 15: 28,409,266 W3610L probably damaging Het
Dnah9 T C 11: 66,005,825 D2391G probably damaging Het
Dnajc10 G A 2: 80,349,293 G724R probably damaging Het
Dst T A 1: 34,188,504 I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 L1391* probably null Het
Dzank1 T C 2: 144,476,092 S718G probably benign Het
E230025N22Rik T C 18: 36,686,837 D300G probably damaging Het
Ebf3 T C 7: 137,312,369 I131V possibly damaging Het
Eif3g T C 9: 20,896,130 I131V probably benign Het
Eppk1 T A 15: 76,106,303 Q2126L possibly damaging Het
Fam83h T C 15: 76,002,333 R1052G probably benign Het
Fry A T 5: 150,295,808 probably benign Het
Ggt6 C T 11: 72,437,297 H208Y possibly damaging Het
Gm15821 T A 17: 34,214,261 E28V unknown Het
Gprin2 T C 14: 34,195,000 Q271R probably damaging Het
Gsdmd T C 15: 75,867,204 F477L probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hmcn2 A G 2: 31,457,955 H4871R possibly damaging Het
Il15ra G A 2: 11,718,422 V86I possibly damaging Het
Il17rb C A 14: 30,002,900 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnab2 T C 4: 152,407,178 Y63C probably damaging Het
Kctd17 A T 15: 78,430,082 Y84F probably damaging Het
Lama1 T A 17: 67,812,496 V2656E Het
Lama2 T C 10: 26,984,371 N3040S probably benign Het
Ldha C T 7: 46,851,009 R173C unknown Het
Lig1 A G 7: 13,303,820 I665M probably damaging Het
Lipe G A 7: 25,384,498 A412V probably damaging Het
Lrrc63 T C 14: 75,084,844 T607A probably benign Het
Majin G A 19: 6,213,397 probably null Het
Map3k19 A G 1: 127,830,438 L335P probably benign Het
Map3k9 A G 12: 81,772,733 L249P probably damaging Het
Mb21d1 C A 9: 78,442,505 V192L probably benign Het
Muc5b G T 7: 141,872,472 D4769Y probably damaging Het
Myh9 T C 15: 77,768,992 T1382A probably benign Het
Nedd4l T A 18: 65,178,924 D407E probably damaging Het
Ngp A G 9: 110,422,383 I160V possibly damaging Het
Nmrk1 A G 19: 18,639,792 probably benign Het
Nnmt C A 9: 48,592,161 K188N probably damaging Het
Nup153 T A 13: 46,684,233 Q1171L probably benign Het
Olfr1012 T G 2: 85,759,535 L280F possibly damaging Het
Oplah T A 15: 76,303,217 E556V probably benign Het
Otog A G 7: 46,288,096 D1743G probably benign Het
Otogl T C 10: 107,777,571 Y2011C probably damaging Het
Pbx4 C T 8: 69,864,447 P118L probably benign Het
Plekha6 T A 1: 133,285,261 S757T probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Polr3a C T 14: 24,469,411 S643N probably damaging Het
Pwp1 T A 10: 85,882,881 L304Q probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab11fip1 A G 8: 27,154,708 F350L probably benign Het
Safb2 T C 17: 56,566,614 E683G probably damaging Het
Serpina3k A G 12: 104,340,971 E154G probably damaging Het
Sgsm3 T A 15: 81,007,981 V250D probably damaging Het
Slit1 T A 19: 41,624,529 I851F probably benign Het
Spag4 G A 2: 156,068,504 G350E probably damaging Het
Sult2a7 A T 7: 14,491,830 L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 T783S probably damaging Het
Thoc6 T C 17: 23,669,888 E182G Het
Tmem132a A T 19: 10,860,161 I595N probably damaging Het
Trim69 A G 2: 122,173,290 N240S probably benign Het
Ush1c A T 7: 46,197,190 probably benign Het
Wnk4 T G 11: 101,262,815 Y234* probably null Het
Zfp943 A G 17: 21,992,340 N136D possibly damaging Het
Znhit2 G A 19: 6,061,639 R138H possibly damaging Het
Other mutations in Scarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Scarb1 APN 5 125289702 missense probably benign 0.01
IGL03052:Scarb1 UTSW 5 125294099 missense probably damaging 1.00
R0051:Scarb1 UTSW 5 125281100 splice site probably null
R0317:Scarb1 UTSW 5 125289692 missense probably damaging 0.99
R0455:Scarb1 UTSW 5 125289681 missense probably damaging 0.96
R0491:Scarb1 UTSW 5 125298731 unclassified probably benign
R0655:Scarb1 UTSW 5 125300440 missense probably damaging 1.00
R0676:Scarb1 UTSW 5 125297214 unclassified probably benign
R2074:Scarb1 UTSW 5 125294143 missense probably benign
R2267:Scarb1 UTSW 5 125287375 missense possibly damaging 0.82
R3951:Scarb1 UTSW 5 125287411 missense probably damaging 0.99
R4080:Scarb1 UTSW 5 125277795 missense probably damaging 1.00
R4452:Scarb1 UTSW 5 125300345 missense probably damaging 1.00
R4925:Scarb1 UTSW 5 125297299 missense probably damaging 1.00
R5669:Scarb1 UTSW 5 125300387 missense probably damaging 1.00
R5809:Scarb1 UTSW 5 125304222 missense probably damaging 0.98
R5872:Scarb1 UTSW 5 125304277 missense possibly damaging 0.60
R5883:Scarb1 UTSW 5 125340907 unclassified probably benign
R6321:Scarb1 UTSW 5 125304331 missense probably damaging 1.00
R6508:Scarb1 UTSW 5 125304325 missense possibly damaging 0.49
R6618:Scarb1 UTSW 5 125304330 missense probably damaging 0.96
R6931:Scarb1 UTSW 5 125284719 missense probably damaging 1.00
R7058:Scarb1 UTSW 5 125297230 missense probably damaging 1.00
R7099:Scarb1 UTSW 5 125304350 missense probably damaging 0.98
R7146:Scarb1 UTSW 5 125284025 missense probably benign
R7830:Scarb1 UTSW 5 125287383 missense probably damaging 1.00
R7873:Scarb1 UTSW 5 125294039 missense probably damaging 1.00
R8158:Scarb1 UTSW 5 125303137 missense probably benign 0.01
R8467:Scarb1 UTSW 5 125298667 missense probably damaging 0.99
R8500:Scarb1 UTSW 5 125294163 missense probably damaging 1.00
R8814:Scarb1 UTSW 5 125294092 missense probably benign 0.00
R9169:Scarb1 UTSW 5 125294082 missense probably damaging 1.00
R9462:Scarb1 UTSW 5 125340827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCTGGAGCAATCAATCTCC -3'
(R):5'- AAGACACGCCTCTTCCTCCG -3'

Sequencing Primer
(F):5'- TCTCCAAAACTCAGCATGGCAG -3'
(R):5'- GTTCTCCAACTAAAGGCTAAGCTG -3'
Posted On 2021-10-11