Mutagenetix > Incidental Mutation

Incidental Mutation 'R9025:Cnot1'

686481

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9025 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95749032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1000 (M1000L)

Ref Sequence

ENSEMBL: ENSMUSP00000063565 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: M1000L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: M1000L

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: M1005L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: M1005L

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: M998L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: M1005L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (80/81)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	G	T	6: 128,557,582	N837K	possibly damaging	Het
Adam29	A	T	8: 55,872,161	C419*	probably null	Het
Adamts7	C	A	9: 90,185,795	S446*	probably null	Het
Ager	A	G	17: 34,600,620	R371G	probably damaging	Het
Apobr	T	A	7: 126,586,457	V380E	possibly damaging	Het
Arhgap26	T	C	18: 39,246,845	S105P		Het
Atrip	A	G	9: 109,073,838	F56S	probably damaging	Het
Bag2	T	C	1: 33,746,824	Y139C		Het
Bccip	C	T	7: 133,717,617	Q146*	probably null	Het
Btbd10	G	A	7: 113,351,824	R20W	possibly damaging	Het
Catsperd	T	A	17: 56,655,156	N443K	probably damaging	Het
Cdh26	G	A	2: 178,462,616	E265K	probably benign	Het
Cep76	T	C	18: 67,634,815	R216G	probably damaging	Het
Cyp1a1	A	G	9: 57,702,787	T495A	possibly damaging	Het
Cyp2w1	T	A	5: 139,356,715	M421K	probably benign	Het
Dlg5	T	C	14: 24,149,478	T1453A	probably benign	Het
Dnah5	G	T	15: 28,409,266	W3610L	probably damaging	Het
Dnah9	T	C	11: 66,005,825	D2391G	probably damaging	Het
Dnajc10	G	A	2: 80,349,293	G724R	probably damaging	Het
Dst	T	A	1: 34,188,504	I1726N	possibly damaging	Het
Dync2h1	A	T	9: 7,139,462	L1391*	probably null	Het
Dzank1	T	C	2: 144,476,092	S718G	probably benign	Het
E230025N22Rik	T	C	18: 36,686,837	D300G	probably damaging	Het
Ebf3	T	C	7: 137,312,369	I131V	possibly damaging	Het
Eif3g	T	C	9: 20,896,130	I131V	probably benign	Het
Eppk1	T	A	15: 76,106,303	Q2126L	possibly damaging	Het
Fam83h	T	C	15: 76,002,333	R1052G	probably benign	Het
Fry	A	T	5: 150,295,808		probably benign	Het
Ggt6	C	T	11: 72,437,297	H208Y	possibly damaging	Het
Gm15821	T	A	17: 34,214,261	E28V	unknown	Het
Gprin2	T	C	14: 34,195,000	Q271R	probably damaging	Het
Gsdmd	T	C	15: 75,867,204	F477L	probably benign	Het
Hes7	T	C	11: 69,122,956	S214P	probably benign	Het
Hmcn2	A	G	2: 31,457,955	H4871R	possibly damaging	Het
Il15ra	G	A	2: 11,718,422	V86I	possibly damaging	Het
Il17rb	C	A	14: 30,002,900		probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kcnab2	T	C	4: 152,407,178	Y63C	probably damaging	Het
Kctd17	A	T	15: 78,430,082	Y84F	probably damaging	Het
Lama1	T	A	17: 67,812,496	V2656E		Het
Lama2	T	C	10: 26,984,371	N3040S	probably benign	Het
Ldha	C	T	7: 46,851,009	R173C	unknown	Het
Lig1	A	G	7: 13,303,820	I665M	probably damaging	Het
Lipe	G	A	7: 25,384,498	A412V	probably damaging	Het
Lrrc63	T	C	14: 75,084,844	T607A	probably benign	Het
Majin	G	A	19: 6,213,397		probably null	Het
Map3k19	A	G	1: 127,830,438	L335P	probably benign	Het
Map3k9	A	G	12: 81,772,733	L249P	probably damaging	Het
Mb21d1	C	A	9: 78,442,505	V192L	probably benign	Het
Muc5b	G	T	7: 141,872,472	D4769Y	probably damaging	Het
Myh9	T	C	15: 77,768,992	T1382A	probably benign	Het
Nedd4l	T	A	18: 65,178,924	D407E	probably damaging	Het
Ngp	A	G	9: 110,422,383	I160V	possibly damaging	Het
Nmrk1	A	G	19: 18,639,792		probably benign	Het
Nnmt	C	A	9: 48,592,161	K188N	probably damaging	Het
Nup153	T	A	13: 46,684,233	Q1171L	probably benign	Het
Olfr1012	T	G	2: 85,759,535	L280F	possibly damaging	Het
Oplah	T	A	15: 76,303,217	E556V	probably benign	Het
Otog	A	G	7: 46,288,096	D1743G	probably benign	Het
Otogl	T	C	10: 107,777,571	Y2011C	probably damaging	Het
Pbx4	C	T	8: 69,864,447	P118L	probably benign	Het
Plekha6	T	A	1: 133,285,261	S757T	probably benign	Het
Plk5	C	G	10: 80,357,996	R40G	probably damaging	Het
Polr3a	C	T	14: 24,469,411	S643N	probably damaging	Het
Pwp1	T	A	10: 85,882,881	L304Q	probably damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rab11fip1	A	G	8: 27,154,708	F350L	probably benign	Het
Safb2	T	C	17: 56,566,614	E683G	probably damaging	Het
Scarb1	A	T	5: 125,304,350	N43K	probably damaging	Het
Serpina3k	A	G	12: 104,340,971	E154G	probably damaging	Het
Sgsm3	T	A	15: 81,007,981	V250D	probably damaging	Het
Slit1	T	A	19: 41,624,529	I851F	probably benign	Het
Spag4	G	A	2: 156,068,504	G350E	probably damaging	Het
Sult2a7	A	T	7: 14,491,830	L77Q	probably damaging	Het
Tbc1d2	T	A	4: 46,607,062	T783S	probably damaging	Het
Thoc6	T	C	17: 23,669,888	E182G		Het
Tmem132a	A	T	19: 10,860,161	I595N	probably damaging	Het
Trim69	A	G	2: 122,173,290	N240S	probably benign	Het
Ush1c	A	T	7: 46,197,190		probably benign	Het
Wnk4	T	G	11: 101,262,815	Y234*	probably null	Het
Zfp943	A	G	17: 21,992,340	N136D	possibly damaging	Het
Znhit2	G	A	19: 6,061,639	R138H	possibly damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TCTTAAAGCTGACTCCCGTTGG -3'
(R):5'- CAGGCTAGTTTAAAGCACTTTACC -3'

Sequencing Primer
(F):5'- ACTCCCGTTGGCTTGGTGAC -3'
(R):5'- ATTGGTGTGCACAGTATCCTC -3'

Posted On

2021-10-11