Incidental Mutation 'R9025:Pwp1'
ID686492
Institutional Source Beutler Lab
Gene Symbol Pwp1
Ensembl Gene ENSMUSG00000001785
Gene NamePWP1 homolog, endonuclein
Synonyms2610205J09Rik, 2310058A11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R9025 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location85829494-85889096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85882881 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 304 (L304Q)
Ref Sequence ENSEMBL: ENSMUSP00000001836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001836] [ENSMUST00000217667] [ENSMUST00000219256]
Predicted Effect probably damaging
Transcript: ENSMUST00000001836
AA Change: L304Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001836
Gene: ENSMUSG00000001785
AA Change: L304Q

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Blast:WD40 168 220 4e-27 BLAST
WD40 244 284 4.51e-7 SMART
WD40 287 327 3.37e-6 SMART
WD40 331 370 4.42e1 SMART
WD40 373 413 6.38e-7 SMART
Blast:WD40 418 458 3e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000217667
Predicted Effect probably benign
Transcript: ENSMUST00000219256
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,557,582 N837K possibly damaging Het
Adam29 A T 8: 55,872,161 C419* probably null Het
Adamts7 C A 9: 90,185,795 S446* probably null Het
Ager A G 17: 34,600,620 R371G probably damaging Het
Apobr T A 7: 126,586,457 V380E possibly damaging Het
Arhgap26 T C 18: 39,246,845 S105P Het
Atrip A G 9: 109,073,838 F56S probably damaging Het
Bag2 T C 1: 33,746,824 Y139C Het
Bccip C T 7: 133,717,617 Q146* probably null Het
Btbd10 G A 7: 113,351,824 R20W possibly damaging Het
Catsperd T A 17: 56,655,156 N443K probably damaging Het
Cdh26 G A 2: 178,462,616 E265K probably benign Het
Cep76 T C 18: 67,634,815 R216G probably damaging Het
Cnot1 T A 8: 95,749,032 M1000L probably benign Het
Cyp1a1 A G 9: 57,702,787 T495A possibly damaging Het
Cyp2w1 T A 5: 139,356,715 M421K probably benign Het
Dlg5 T C 14: 24,149,478 T1453A probably benign Het
Dnah5 G T 15: 28,409,266 W3610L probably damaging Het
Dnah9 T C 11: 66,005,825 D2391G probably damaging Het
Dnajc10 G A 2: 80,349,293 G724R probably damaging Het
Dst T A 1: 34,188,504 I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 L1391* probably null Het
Dzank1 T C 2: 144,476,092 S718G probably benign Het
E230025N22Rik T C 18: 36,686,837 D300G probably damaging Het
Ebf3 T C 7: 137,312,369 I131V possibly damaging Het
Eif3g T C 9: 20,896,130 I131V probably benign Het
Eppk1 T A 15: 76,106,303 Q2126L possibly damaging Het
Fam83h T C 15: 76,002,333 R1052G probably benign Het
Ggt6 C T 11: 72,437,297 H208Y possibly damaging Het
Gm15821 T A 17: 34,214,261 E28V unknown Het
Gprin2 T C 14: 34,195,000 Q271R probably damaging Het
Gsdmd T C 15: 75,867,204 F477L probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hmcn2 A G 2: 31,457,955 H4871R possibly damaging Het
Il15ra G A 2: 11,718,422 V86I possibly damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnab2 T C 4: 152,407,178 Y63C probably damaging Het
Kctd17 A T 15: 78,430,082 Y84F probably damaging Het
Lama1 T A 17: 67,812,496 V2656E Het
Lama2 T C 10: 26,984,371 N3040S probably benign Het
Ldha C T 7: 46,851,009 R173C unknown Het
Lig1 A G 7: 13,303,820 I665M probably damaging Het
Lipe G A 7: 25,384,498 A412V probably damaging Het
Lrrc63 T C 14: 75,084,844 T607A probably benign Het
Majin G A 19: 6,213,397 probably null Het
Map3k19 A G 1: 127,830,438 L335P probably benign Het
Map3k9 A G 12: 81,772,733 L249P probably damaging Het
Mb21d1 C A 9: 78,442,505 V192L probably benign Het
Muc5b G T 7: 141,872,472 D4769Y probably damaging Het
Myh9 T C 15: 77,768,992 T1382A probably benign Het
Nedd4l T A 18: 65,178,924 D407E probably damaging Het
Ngp A G 9: 110,422,383 I160V possibly damaging Het
Nnmt C A 9: 48,592,161 K188N probably damaging Het
Nup153 T A 13: 46,684,233 Q1171L probably benign Het
Olfr1012 T G 2: 85,759,535 L280F possibly damaging Het
Oplah T A 15: 76,303,217 E556V probably benign Het
Otog A G 7: 46,288,096 D1743G probably benign Het
Otogl T C 10: 107,777,571 Y2011C probably damaging Het
Pbx4 C T 8: 69,864,447 P118L probably benign Het
Plekha6 T A 1: 133,285,261 S757T probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Polr3a C T 14: 24,469,411 S643N probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab11fip1 A G 8: 27,154,708 F350L probably benign Het
Safb2 T C 17: 56,566,614 E683G probably damaging Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Serpina3k A G 12: 104,340,971 E154G probably damaging Het
Sgsm3 T A 15: 81,007,981 V250D probably damaging Het
Slit1 T A 19: 41,624,529 I851F probably benign Het
Spag4 G A 2: 156,068,504 G350E probably damaging Het
Sult2a7 A T 7: 14,491,830 L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 T783S probably damaging Het
Thoc6 T C 17: 23,669,888 E182G Het
Tmem132a A T 19: 10,860,161 I595N probably damaging Het
Trim69 A G 2: 122,173,290 N240S probably benign Het
Wnk4 T G 11: 101,262,815 Y234* probably null Het
Zfp943 A G 17: 21,992,340 N136D possibly damaging Het
Znhit2 G A 19: 6,061,639 R138H possibly damaging Het
Other mutations in Pwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Pwp1 APN 10 85878516 missense probably damaging 1.00
IGL00778:Pwp1 APN 10 85879888 missense probably benign 0.05
IGL01086:Pwp1 APN 10 85879893 splice site probably null
IGL02526:Pwp1 APN 10 85882103 splice site probably null
IGL02596:Pwp1 APN 10 85872018 splice site probably null
IGL03164:Pwp1 APN 10 85878503 missense probably benign 0.19
IGL03269:Pwp1 APN 10 85882904 missense probably damaging 0.98
Annuals UTSW 10 85876514 missense probably damaging 1.00
R0031:Pwp1 UTSW 10 85885896 missense probably benign 0.20
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0049:Pwp1 UTSW 10 85885616 missense possibly damaging 0.67
R0766:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R0926:Pwp1 UTSW 10 85876514 missense probably damaging 1.00
R1238:Pwp1 UTSW 10 85885862 missense probably benign 0.02
R1312:Pwp1 UTSW 10 85879309 missense probably damaging 0.98
R1420:Pwp1 UTSW 10 85876538 missense probably damaging 1.00
R3177:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3277:Pwp1 UTSW 10 85882079 missense probably benign 0.45
R3818:Pwp1 UTSW 10 85888129 missense possibly damaging 0.76
R4008:Pwp1 UTSW 10 85882034 missense possibly damaging 0.60
R5964:Pwp1 UTSW 10 85882886 missense probably damaging 1.00
R6252:Pwp1 UTSW 10 85874509 missense probably benign 0.00
R6280:Pwp1 UTSW 10 85874462 missense probably damaging 0.99
R6765:Pwp1 UTSW 10 85884533 missense probably damaging 0.99
R7168:Pwp1 UTSW 10 85884537 missense probably damaging 1.00
R7213:Pwp1 UTSW 10 85876309 missense probably benign
R7236:Pwp1 UTSW 10 85879283 missense probably benign 0.00
R7840:Pwp1 UTSW 10 85888050 missense probably damaging 1.00
R9063:Pwp1 UTSW 10 85884567 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTACATTATTCTTAGAAGTGCTAGCC -3'
(R):5'- TTGTCTTAGTGCAGGCAGAGC -3'

Sequencing Primer
(F):5'- ATTAGGCCAGCCAGCTCTATGTAG -3'
(R):5'- TCTTAGTGCAGGCAGAGCTCAAG -3'
Posted On2021-10-11