Incidental Mutation 'R9025:Polr3a'
ID 686503
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 068854-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9025 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24519479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 643 (S643N)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: S643N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: S643N

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
AA Change: V648M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,534,545 (GRCm39) N837K possibly damaging Het
Adam29 A T 8: 56,325,196 (GRCm39) C419* probably null Het
Adamts7 C A 9: 90,067,848 (GRCm39) S446* probably null Het
Ager A G 17: 34,819,594 (GRCm39) R371G probably damaging Het
Apobr T A 7: 126,185,629 (GRCm39) V380E possibly damaging Het
Arhgap26 T C 18: 39,379,898 (GRCm39) S105P Het
Atrip A G 9: 108,902,906 (GRCm39) F56S probably damaging Het
Bag2 T C 1: 33,785,905 (GRCm39) Y139C Het
Bccip C T 7: 133,319,346 (GRCm39) Q146* probably null Het
Btbd10 G A 7: 112,951,031 (GRCm39) R20W possibly damaging Het
Catsperd T A 17: 56,962,156 (GRCm39) N443K probably damaging Het
Cdh26 G A 2: 178,104,409 (GRCm39) E265K probably benign Het
Cep76 T C 18: 67,767,885 (GRCm39) R216G probably damaging Het
Cgas C A 9: 78,349,787 (GRCm39) V192L probably benign Het
Cnot1 T A 8: 96,475,660 (GRCm39) M1000L probably benign Het
Cyp1a1 A G 9: 57,610,070 (GRCm39) T495A possibly damaging Het
Cyp2w1 T A 5: 139,342,470 (GRCm39) M421K probably benign Het
Dlg5 T C 14: 24,199,546 (GRCm39) T1453A probably benign Het
Dnah5 G T 15: 28,409,412 (GRCm39) W3610L probably damaging Het
Dnah9 T C 11: 65,896,651 (GRCm39) D2391G probably damaging Het
Dnajc10 G A 2: 80,179,637 (GRCm39) G724R probably damaging Het
Dst T A 1: 34,227,585 (GRCm39) I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 (GRCm39) L1391* probably null Het
Dzank1 T C 2: 144,318,012 (GRCm39) S718G probably benign Het
E230025N22Rik T C 18: 36,819,890 (GRCm39) D300G probably damaging Het
Ebf3 T C 7: 136,914,098 (GRCm39) I131V possibly damaging Het
Eif3g T C 9: 20,807,426 (GRCm39) I131V probably benign Het
Eppk1 T A 15: 75,990,503 (GRCm39) Q2126L possibly damaging Het
Fam83h T C 15: 75,874,182 (GRCm39) R1052G probably benign Het
Fry A T 5: 150,219,273 (GRCm39) probably benign Het
Ggt6 C T 11: 72,328,123 (GRCm39) H208Y possibly damaging Het
Gm15821 T A 17: 34,433,235 (GRCm39) E28V unknown Het
Gprin2 T C 14: 33,916,957 (GRCm39) Q271R probably damaging Het
Gsdmd T C 15: 75,739,053 (GRCm39) F477L probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hmcn2 A G 2: 31,347,967 (GRCm39) H4871R possibly damaging Het
Il15ra G A 2: 11,723,233 (GRCm39) V86I possibly damaging Het
Il17rb C A 14: 29,724,857 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnab2 T C 4: 152,491,635 (GRCm39) Y63C probably damaging Het
Kctd17 A T 15: 78,314,282 (GRCm39) Y84F probably damaging Het
Lama1 T A 17: 68,119,491 (GRCm39) V2656E Het
Lama2 T C 10: 26,860,367 (GRCm39) N3040S probably benign Het
Ldha C T 7: 46,500,433 (GRCm39) R173C unknown Het
Lig1 A G 7: 13,037,746 (GRCm39) I665M probably damaging Het
Lipe G A 7: 25,083,923 (GRCm39) A412V probably damaging Het
Lrrc63 T C 14: 75,322,284 (GRCm39) T607A probably benign Het
Majin G A 19: 6,263,427 (GRCm39) probably null Het
Map3k19 A G 1: 127,758,175 (GRCm39) L335P probably benign Het
Map3k9 A G 12: 81,819,507 (GRCm39) L249P probably damaging Het
Muc5b G T 7: 141,426,209 (GRCm39) D4769Y probably damaging Het
Myh9 T C 15: 77,653,192 (GRCm39) T1382A probably benign Het
Nedd4l T A 18: 65,311,995 (GRCm39) D407E probably damaging Het
Ngp A G 9: 110,251,451 (GRCm39) I160V possibly damaging Het
Nmrk1 A G 19: 18,617,156 (GRCm39) probably benign Het
Nnmt C A 9: 48,503,461 (GRCm39) K188N probably damaging Het
Nup153 T A 13: 46,837,709 (GRCm39) Q1171L probably benign Het
Oplah T A 15: 76,187,417 (GRCm39) E556V probably benign Het
Or9g3 T G 2: 85,589,879 (GRCm39) L280F possibly damaging Het
Otog A G 7: 45,937,520 (GRCm39) D1743G probably benign Het
Otogl T C 10: 107,613,432 (GRCm39) Y2011C probably damaging Het
Pbx4 C T 8: 70,317,097 (GRCm39) P118L probably benign Het
Plekha6 T A 1: 133,212,999 (GRCm39) S757T probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Pwp1 T A 10: 85,718,745 (GRCm39) L304Q probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,644,736 (GRCm39) F350L probably benign Het
Safb2 T C 17: 56,873,614 (GRCm39) E683G probably damaging Het
Scarb1 A T 5: 125,381,414 (GRCm39) N43K probably damaging Het
Serpina3k A G 12: 104,307,230 (GRCm39) E154G probably damaging Het
Sgsm3 T A 15: 80,892,182 (GRCm39) V250D probably damaging Het
Slit1 T A 19: 41,612,968 (GRCm39) I851F probably benign Het
Spag4 G A 2: 155,910,424 (GRCm39) G350E probably damaging Het
Sult2a7 A T 7: 14,225,755 (GRCm39) L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 (GRCm39) T783S probably damaging Het
Thoc6 T C 17: 23,888,862 (GRCm39) E182G Het
Tmem132a A T 19: 10,837,525 (GRCm39) I595N probably damaging Het
Trim69 A G 2: 122,003,771 (GRCm39) N240S probably benign Het
Ush1c A T 7: 45,846,614 (GRCm39) probably benign Het
Wnk4 T G 11: 101,153,641 (GRCm39) Y234* probably null Het
Zfp943 A G 17: 22,211,321 (GRCm39) N136D possibly damaging Het
Znhit2 G A 19: 6,111,669 (GRCm39) R138H possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCGGCATTAACGTGAGAC -3'
(R):5'- AGGAGGTCAGGACTTCTACTGTG -3'

Sequencing Primer
(F):5'- TGAGACACGAAGCTACTGAGATACTC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2021-10-11