Incidental Mutation 'R9025:Polr3a'
ID 686503
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC1, 9330175N20Rik, RPC155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9025 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 24448696-24487058 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24469411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 643 (S643N)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: S643N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: S643N

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
AA Change: V648M

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,557,582 N837K possibly damaging Het
Adam29 A T 8: 55,872,161 C419* probably null Het
Adamts7 C A 9: 90,185,795 S446* probably null Het
Ager A G 17: 34,600,620 R371G probably damaging Het
Apobr T A 7: 126,586,457 V380E possibly damaging Het
Arhgap26 T C 18: 39,246,845 S105P Het
Atrip A G 9: 109,073,838 F56S probably damaging Het
Bag2 T C 1: 33,746,824 Y139C Het
Bccip C T 7: 133,717,617 Q146* probably null Het
Btbd10 G A 7: 113,351,824 R20W possibly damaging Het
Catsperd T A 17: 56,655,156 N443K probably damaging Het
Cdh26 G A 2: 178,462,616 E265K probably benign Het
Cep76 T C 18: 67,634,815 R216G probably damaging Het
Cnot1 T A 8: 95,749,032 M1000L probably benign Het
Cyp1a1 A G 9: 57,702,787 T495A possibly damaging Het
Cyp2w1 T A 5: 139,356,715 M421K probably benign Het
Dlg5 T C 14: 24,149,478 T1453A probably benign Het
Dnah5 G T 15: 28,409,266 W3610L probably damaging Het
Dnah9 T C 11: 66,005,825 D2391G probably damaging Het
Dnajc10 G A 2: 80,349,293 G724R probably damaging Het
Dst T A 1: 34,188,504 I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 L1391* probably null Het
Dzank1 T C 2: 144,476,092 S718G probably benign Het
E230025N22Rik T C 18: 36,686,837 D300G probably damaging Het
Ebf3 T C 7: 137,312,369 I131V possibly damaging Het
Eif3g T C 9: 20,896,130 I131V probably benign Het
Eppk1 T A 15: 76,106,303 Q2126L possibly damaging Het
Fam83h T C 15: 76,002,333 R1052G probably benign Het
Fry A T 5: 150,295,808 probably benign Het
Ggt6 C T 11: 72,437,297 H208Y possibly damaging Het
Gm15821 T A 17: 34,214,261 E28V unknown Het
Gprin2 T C 14: 34,195,000 Q271R probably damaging Het
Gsdmd T C 15: 75,867,204 F477L probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hmcn2 A G 2: 31,457,955 H4871R possibly damaging Het
Il15ra G A 2: 11,718,422 V86I possibly damaging Het
Il17rb C A 14: 30,002,900 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnab2 T C 4: 152,407,178 Y63C probably damaging Het
Kctd17 A T 15: 78,430,082 Y84F probably damaging Het
Lama1 T A 17: 67,812,496 V2656E Het
Lama2 T C 10: 26,984,371 N3040S probably benign Het
Ldha C T 7: 46,851,009 R173C unknown Het
Lig1 A G 7: 13,303,820 I665M probably damaging Het
Lipe G A 7: 25,384,498 A412V probably damaging Het
Lrrc63 T C 14: 75,084,844 T607A probably benign Het
Majin G A 19: 6,213,397 probably null Het
Map3k19 A G 1: 127,830,438 L335P probably benign Het
Map3k9 A G 12: 81,772,733 L249P probably damaging Het
Mb21d1 C A 9: 78,442,505 V192L probably benign Het
Muc5b G T 7: 141,872,472 D4769Y probably damaging Het
Myh9 T C 15: 77,768,992 T1382A probably benign Het
Nedd4l T A 18: 65,178,924 D407E probably damaging Het
Ngp A G 9: 110,422,383 I160V possibly damaging Het
Nmrk1 A G 19: 18,639,792 probably benign Het
Nnmt C A 9: 48,592,161 K188N probably damaging Het
Nup153 T A 13: 46,684,233 Q1171L probably benign Het
Olfr1012 T G 2: 85,759,535 L280F possibly damaging Het
Oplah T A 15: 76,303,217 E556V probably benign Het
Otog A G 7: 46,288,096 D1743G probably benign Het
Otogl T C 10: 107,777,571 Y2011C probably damaging Het
Pbx4 C T 8: 69,864,447 P118L probably benign Het
Plekha6 T A 1: 133,285,261 S757T probably benign Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Pwp1 T A 10: 85,882,881 L304Q probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rab11fip1 A G 8: 27,154,708 F350L probably benign Het
Safb2 T C 17: 56,566,614 E683G probably damaging Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Serpina3k A G 12: 104,340,971 E154G probably damaging Het
Sgsm3 T A 15: 81,007,981 V250D probably damaging Het
Slit1 T A 19: 41,624,529 I851F probably benign Het
Spag4 G A 2: 156,068,504 G350E probably damaging Het
Sult2a7 A T 7: 14,491,830 L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 T783S probably damaging Het
Thoc6 T C 17: 23,669,888 E182G Het
Tmem132a A T 19: 10,860,161 I595N probably damaging Het
Trim69 A G 2: 122,173,290 N240S probably benign Het
Ush1c A T 7: 46,197,190 probably benign Het
Wnk4 T G 11: 101,262,815 Y234* probably null Het
Zfp943 A G 17: 21,992,340 N136D possibly damaging Het
Znhit2 G A 19: 6,061,639 R138H possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
R8753:Polr3a UTSW 14 24463634 nonsense probably null
R8785:Polr3a UTSW 14 24452315 missense probably benign 0.06
R8848:Polr3a UTSW 14 24450766 missense probably damaging 1.00
R9139:Polr3a UTSW 14 24469348 missense probably damaging 1.00
R9264:Polr3a UTSW 14 24470831 missense probably benign
R9309:Polr3a UTSW 14 24459999 missense probably benign
R9363:Polr3a UTSW 14 24450763 missense probably damaging 1.00
R9526:Polr3a UTSW 14 24453245 missense probably benign 0.00
R9585:Polr3a UTSW 14 24452221 missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCGGCATTAACGTGAGAC -3'
(R):5'- AGGAGGTCAGGACTTCTACTGTG -3'

Sequencing Primer
(F):5'- TGAGACACGAAGCTACTGAGATACTC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2021-10-11