Incidental Mutation 'R9025:Lama1'
ID 686521
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Name laminin, alpha 1
Synonyms Lama
MMRRC Submission 068854-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9025 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 68004254-68129642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68119491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2656 (V2656E)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: V2656E

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,534,545 (GRCm39) N837K possibly damaging Het
Adam29 A T 8: 56,325,196 (GRCm39) C419* probably null Het
Adamts7 C A 9: 90,067,848 (GRCm39) S446* probably null Het
Ager A G 17: 34,819,594 (GRCm39) R371G probably damaging Het
Apobr T A 7: 126,185,629 (GRCm39) V380E possibly damaging Het
Arhgap26 T C 18: 39,379,898 (GRCm39) S105P Het
Atrip A G 9: 108,902,906 (GRCm39) F56S probably damaging Het
Bag2 T C 1: 33,785,905 (GRCm39) Y139C Het
Bccip C T 7: 133,319,346 (GRCm39) Q146* probably null Het
Btbd10 G A 7: 112,951,031 (GRCm39) R20W possibly damaging Het
Catsperd T A 17: 56,962,156 (GRCm39) N443K probably damaging Het
Cdh26 G A 2: 178,104,409 (GRCm39) E265K probably benign Het
Cep76 T C 18: 67,767,885 (GRCm39) R216G probably damaging Het
Cgas C A 9: 78,349,787 (GRCm39) V192L probably benign Het
Cnot1 T A 8: 96,475,660 (GRCm39) M1000L probably benign Het
Cyp1a1 A G 9: 57,610,070 (GRCm39) T495A possibly damaging Het
Cyp2w1 T A 5: 139,342,470 (GRCm39) M421K probably benign Het
Dlg5 T C 14: 24,199,546 (GRCm39) T1453A probably benign Het
Dnah5 G T 15: 28,409,412 (GRCm39) W3610L probably damaging Het
Dnah9 T C 11: 65,896,651 (GRCm39) D2391G probably damaging Het
Dnajc10 G A 2: 80,179,637 (GRCm39) G724R probably damaging Het
Dst T A 1: 34,227,585 (GRCm39) I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 (GRCm39) L1391* probably null Het
Dzank1 T C 2: 144,318,012 (GRCm39) S718G probably benign Het
E230025N22Rik T C 18: 36,819,890 (GRCm39) D300G probably damaging Het
Ebf3 T C 7: 136,914,098 (GRCm39) I131V possibly damaging Het
Eif3g T C 9: 20,807,426 (GRCm39) I131V probably benign Het
Eppk1 T A 15: 75,990,503 (GRCm39) Q2126L possibly damaging Het
Fam83h T C 15: 75,874,182 (GRCm39) R1052G probably benign Het
Fry A T 5: 150,219,273 (GRCm39) probably benign Het
Ggt6 C T 11: 72,328,123 (GRCm39) H208Y possibly damaging Het
Gm15821 T A 17: 34,433,235 (GRCm39) E28V unknown Het
Gprin2 T C 14: 33,916,957 (GRCm39) Q271R probably damaging Het
Gsdmd T C 15: 75,739,053 (GRCm39) F477L probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hmcn2 A G 2: 31,347,967 (GRCm39) H4871R possibly damaging Het
Il15ra G A 2: 11,723,233 (GRCm39) V86I possibly damaging Het
Il17rb C A 14: 29,724,857 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnab2 T C 4: 152,491,635 (GRCm39) Y63C probably damaging Het
Kctd17 A T 15: 78,314,282 (GRCm39) Y84F probably damaging Het
Lama2 T C 10: 26,860,367 (GRCm39) N3040S probably benign Het
Ldha C T 7: 46,500,433 (GRCm39) R173C unknown Het
Lig1 A G 7: 13,037,746 (GRCm39) I665M probably damaging Het
Lipe G A 7: 25,083,923 (GRCm39) A412V probably damaging Het
Lrrc63 T C 14: 75,322,284 (GRCm39) T607A probably benign Het
Majin G A 19: 6,263,427 (GRCm39) probably null Het
Map3k19 A G 1: 127,758,175 (GRCm39) L335P probably benign Het
Map3k9 A G 12: 81,819,507 (GRCm39) L249P probably damaging Het
Muc5b G T 7: 141,426,209 (GRCm39) D4769Y probably damaging Het
Myh9 T C 15: 77,653,192 (GRCm39) T1382A probably benign Het
Nedd4l T A 18: 65,311,995 (GRCm39) D407E probably damaging Het
Ngp A G 9: 110,251,451 (GRCm39) I160V possibly damaging Het
Nmrk1 A G 19: 18,617,156 (GRCm39) probably benign Het
Nnmt C A 9: 48,503,461 (GRCm39) K188N probably damaging Het
Nup153 T A 13: 46,837,709 (GRCm39) Q1171L probably benign Het
Oplah T A 15: 76,187,417 (GRCm39) E556V probably benign Het
Or9g3 T G 2: 85,589,879 (GRCm39) L280F possibly damaging Het
Otog A G 7: 45,937,520 (GRCm39) D1743G probably benign Het
Otogl T C 10: 107,613,432 (GRCm39) Y2011C probably damaging Het
Pbx4 C T 8: 70,317,097 (GRCm39) P118L probably benign Het
Plekha6 T A 1: 133,212,999 (GRCm39) S757T probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Polr3a C T 14: 24,519,479 (GRCm39) S643N probably damaging Het
Pwp1 T A 10: 85,718,745 (GRCm39) L304Q probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,644,736 (GRCm39) F350L probably benign Het
Safb2 T C 17: 56,873,614 (GRCm39) E683G probably damaging Het
Scarb1 A T 5: 125,381,414 (GRCm39) N43K probably damaging Het
Serpina3k A G 12: 104,307,230 (GRCm39) E154G probably damaging Het
Sgsm3 T A 15: 80,892,182 (GRCm39) V250D probably damaging Het
Slit1 T A 19: 41,612,968 (GRCm39) I851F probably benign Het
Spag4 G A 2: 155,910,424 (GRCm39) G350E probably damaging Het
Sult2a7 A T 7: 14,225,755 (GRCm39) L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 (GRCm39) T783S probably damaging Het
Thoc6 T C 17: 23,888,862 (GRCm39) E182G Het
Tmem132a A T 19: 10,837,525 (GRCm39) I595N probably damaging Het
Trim69 A G 2: 122,003,771 (GRCm39) N240S probably benign Het
Ush1c A T 7: 45,846,614 (GRCm39) probably benign Het
Wnk4 T G 11: 101,153,641 (GRCm39) Y234* probably null Het
Zfp943 A G 17: 22,211,321 (GRCm39) N136D possibly damaging Het
Znhit2 G A 19: 6,111,669 (GRCm39) R138H possibly damaging Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 68,122,923 (GRCm39) missense probably benign
IGL00336:Lama1 APN 17 68,120,943 (GRCm39) missense probably benign 0.07
IGL01066:Lama1 APN 17 68,050,321 (GRCm39) missense probably damaging 1.00
IGL01140:Lama1 APN 17 68,109,928 (GRCm39) missense probably benign 0.14
IGL01291:Lama1 APN 17 68,045,865 (GRCm39) missense probably damaging 1.00
IGL01296:Lama1 APN 17 68,052,046 (GRCm39) missense probably benign 0.27
IGL01317:Lama1 APN 17 68,125,696 (GRCm39) missense probably damaging 1.00
IGL01490:Lama1 APN 17 68,057,579 (GRCm39) missense possibly damaging 0.54
IGL01506:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01508:Lama1 APN 17 68,116,356 (GRCm39) splice site probably benign
IGL01522:Lama1 APN 17 68,059,769 (GRCm39) splice site probably benign
IGL01530:Lama1 APN 17 68,103,785 (GRCm39) missense probably benign 0.02
IGL01541:Lama1 APN 17 68,092,065 (GRCm39) missense probably benign 0.01
IGL01677:Lama1 APN 17 68,086,143 (GRCm39) missense probably benign 0.15
IGL01886:Lama1 APN 17 68,114,792 (GRCm39) missense probably benign 0.36
IGL01994:Lama1 APN 17 68,059,434 (GRCm39) missense probably benign 0.05
IGL02017:Lama1 APN 17 68,071,720 (GRCm39) missense probably benign 0.00
IGL02021:Lama1 APN 17 68,128,621 (GRCm39) missense probably damaging 1.00
IGL02026:Lama1 APN 17 68,116,287 (GRCm39) missense possibly damaging 0.82
IGL02044:Lama1 APN 17 68,118,485 (GRCm39) missense probably benign 0.01
IGL02120:Lama1 APN 17 68,023,784 (GRCm39) missense probably damaging 1.00
IGL02425:Lama1 APN 17 68,118,480 (GRCm39) missense probably benign 0.45
IGL02549:Lama1 APN 17 68,097,830 (GRCm39) missense possibly damaging 0.93
IGL02642:Lama1 APN 17 68,119,361 (GRCm39) missense probably benign 0.00
IGL02795:Lama1 APN 17 68,045,889 (GRCm39) splice site probably null
IGL02798:Lama1 APN 17 68,102,186 (GRCm39) splice site probably benign
IGL02863:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02870:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02876:Lama1 APN 17 68,057,687 (GRCm39) critical splice donor site probably null
IGL02885:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02891:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL02978:Lama1 APN 17 68,093,076 (GRCm39) nonsense probably null
IGL03064:Lama1 APN 17 68,086,099 (GRCm39) missense probably benign 0.01
IGL03076:Lama1 APN 17 68,023,794 (GRCm39) missense possibly damaging 0.95
IGL03110:Lama1 APN 17 68,105,981 (GRCm39) missense probably benign 0.04
IGL03143:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03159:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
IGL03268:Lama1 APN 17 68,111,531 (GRCm39) missense probably damaging 0.99
ANU05:Lama1 UTSW 17 68,045,865 (GRCm39) missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 68,071,699 (GRCm39) missense
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0047:Lama1 UTSW 17 68,102,181 (GRCm39) splice site probably benign
R0050:Lama1 UTSW 17 68,089,051 (GRCm39) missense possibly damaging 0.66
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0096:Lama1 UTSW 17 68,112,408 (GRCm39) missense probably benign 0.12
R0111:Lama1 UTSW 17 68,044,493 (GRCm39) missense probably damaging 0.98
R0116:Lama1 UTSW 17 68,083,918 (GRCm39) missense probably benign 0.10
R0121:Lama1 UTSW 17 68,105,508 (GRCm39) splice site probably benign
R0278:Lama1 UTSW 17 68,117,178 (GRCm39) missense probably null 0.98
R0281:Lama1 UTSW 17 68,124,564 (GRCm39) missense probably damaging 1.00
R0312:Lama1 UTSW 17 68,082,846 (GRCm39) missense possibly damaging 0.45
R0419:Lama1 UTSW 17 68,098,605 (GRCm39) critical splice donor site probably null
R0512:Lama1 UTSW 17 68,086,129 (GRCm39) missense possibly damaging 0.67
R0514:Lama1 UTSW 17 68,071,693 (GRCm39) missense probably benign 0.40
R0562:Lama1 UTSW 17 68,122,954 (GRCm39) missense probably damaging 1.00
R0632:Lama1 UTSW 17 68,059,363 (GRCm39) splice site probably benign
R0645:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R0712:Lama1 UTSW 17 68,086,037 (GRCm39) splice site probably null
R0763:Lama1 UTSW 17 68,079,813 (GRCm39) missense probably damaging 0.97
R0941:Lama1 UTSW 17 68,082,860 (GRCm39) missense probably benign 0.10
R1025:Lama1 UTSW 17 68,059,893 (GRCm39) missense probably benign 0.00
R1084:Lama1 UTSW 17 68,111,464 (GRCm39) missense probably benign 0.12
R1103:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1420:Lama1 UTSW 17 68,097,942 (GRCm39) missense probably damaging 0.98
R1430:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R1569:Lama1 UTSW 17 68,087,613 (GRCm39) splice site probably null
R1575:Lama1 UTSW 17 68,117,404 (GRCm39) missense possibly damaging 0.96
R1613:Lama1 UTSW 17 68,114,918 (GRCm39) missense probably benign 0.42
R1620:Lama1 UTSW 17 68,074,028 (GRCm39) missense probably benign 0.01
R1629:Lama1 UTSW 17 68,112,423 (GRCm39) missense probably benign 0.00
R1645:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably benign 0.14
R1652:Lama1 UTSW 17 68,114,841 (GRCm39) missense probably damaging 0.97
R1674:Lama1 UTSW 17 68,098,239 (GRCm39) missense probably benign
R1678:Lama1 UTSW 17 68,117,150 (GRCm39) missense possibly damaging 0.56
R1710:Lama1 UTSW 17 68,060,786 (GRCm39) missense probably benign 0.00
R1712:Lama1 UTSW 17 68,024,181 (GRCm39) missense possibly damaging 0.95
R1737:Lama1 UTSW 17 68,109,916 (GRCm39) missense probably benign 0.36
R1757:Lama1 UTSW 17 68,004,378 (GRCm39) missense unknown
R1757:Lama1 UTSW 17 68,070,831 (GRCm39) missense probably benign 0.40
R1813:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1896:Lama1 UTSW 17 68,098,218 (GRCm39) missense probably benign
R1945:Lama1 UTSW 17 68,052,848 (GRCm39) missense probably benign 0.14
R2086:Lama1 UTSW 17 68,124,618 (GRCm39) missense probably damaging 1.00
R2149:Lama1 UTSW 17 68,080,860 (GRCm39) missense possibly damaging 0.95
R2178:Lama1 UTSW 17 68,076,510 (GRCm39) missense probably benign 0.07
R2183:Lama1 UTSW 17 68,098,004 (GRCm39) missense probably damaging 0.98
R2197:Lama1 UTSW 17 68,059,936 (GRCm39) missense probably benign 0.02
R2213:Lama1 UTSW 17 68,084,029 (GRCm39) nonsense probably null
R2260:Lama1 UTSW 17 68,044,502 (GRCm39) missense probably damaging 0.96
R2356:Lama1 UTSW 17 68,117,109 (GRCm39) missense probably damaging 1.00
R2420:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2421:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2422:Lama1 UTSW 17 68,057,548 (GRCm39) missense probably benign 0.00
R2424:Lama1 UTSW 17 68,105,660 (GRCm39) missense probably benign 0.09
R2442:Lama1 UTSW 17 68,075,312 (GRCm39) missense probably benign 0.04
R3147:Lama1 UTSW 17 68,044,653 (GRCm39) missense probably damaging 0.98
R3414:Lama1 UTSW 17 68,044,598 (GRCm39) missense probably damaging 1.00
R3683:Lama1 UTSW 17 68,075,328 (GRCm39) missense probably benign 0.40
R3820:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3821:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R3822:Lama1 UTSW 17 68,086,041 (GRCm39) splice site probably null
R4012:Lama1 UTSW 17 68,119,368 (GRCm39) nonsense probably null
R4113:Lama1 UTSW 17 68,071,698 (GRCm39) missense probably benign 0.01
R4133:Lama1 UTSW 17 68,119,481 (GRCm39) missense probably damaging 1.00
R4133:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R4259:Lama1 UTSW 17 68,059,413 (GRCm39) missense possibly damaging 0.95
R4278:Lama1 UTSW 17 68,098,512 (GRCm39) missense probably null 0.00
R4321:Lama1 UTSW 17 68,078,078 (GRCm39) missense probably benign 0.03
R4374:Lama1 UTSW 17 68,111,513 (GRCm39) missense probably benign 0.00
R4386:Lama1 UTSW 17 68,080,707 (GRCm39) missense probably benign 0.01
R4463:Lama1 UTSW 17 68,068,695 (GRCm39) missense probably damaging 1.00
R4629:Lama1 UTSW 17 68,112,355 (GRCm39) critical splice acceptor site probably null
R4630:Lama1 UTSW 17 68,101,295 (GRCm39) missense probably benign 0.00
R4633:Lama1 UTSW 17 68,105,579 (GRCm39) missense probably damaging 0.96
R4668:Lama1 UTSW 17 68,059,429 (GRCm39) missense probably benign 0.27
R4684:Lama1 UTSW 17 68,080,773 (GRCm39) missense possibly damaging 0.88
R4745:Lama1 UTSW 17 68,045,775 (GRCm39) missense probably damaging 1.00
R4786:Lama1 UTSW 17 68,080,854 (GRCm39) missense possibly damaging 0.77
R4797:Lama1 UTSW 17 68,023,770 (GRCm39) missense probably benign 0.04
R4803:Lama1 UTSW 17 68,116,266 (GRCm39) missense probably damaging 1.00
R4925:Lama1 UTSW 17 68,101,309 (GRCm39) missense probably benign 0.02
R4939:Lama1 UTSW 17 68,044,470 (GRCm39) missense possibly damaging 0.91
R4952:Lama1 UTSW 17 68,074,561 (GRCm39) critical splice donor site probably null
R4975:Lama1 UTSW 17 68,045,829 (GRCm39) missense possibly damaging 0.95
R4977:Lama1 UTSW 17 68,044,677 (GRCm39) missense probably damaging 1.00
R5039:Lama1 UTSW 17 68,052,888 (GRCm39) missense possibly damaging 0.66
R5047:Lama1 UTSW 17 68,050,276 (GRCm39) nonsense probably null
R5195:Lama1 UTSW 17 68,071,795 (GRCm39) missense probably benign 0.13
R5230:Lama1 UTSW 17 68,052,078 (GRCm39) nonsense probably null
R5236:Lama1 UTSW 17 68,111,487 (GRCm39) missense probably benign 0.24
R5254:Lama1 UTSW 17 68,063,711 (GRCm39) missense probably benign 0.01
R5345:Lama1 UTSW 17 68,124,558 (GRCm39) missense probably benign
R5438:Lama1 UTSW 17 68,107,769 (GRCm39) missense possibly damaging 0.92
R5521:Lama1 UTSW 17 68,087,889 (GRCm39) nonsense probably null
R5568:Lama1 UTSW 17 68,075,293 (GRCm39) critical splice acceptor site probably null
R5645:Lama1 UTSW 17 68,109,943 (GRCm39) missense probably damaging 1.00
R5665:Lama1 UTSW 17 68,077,982 (GRCm39) missense probably damaging 1.00
R5727:Lama1 UTSW 17 68,122,219 (GRCm39) missense possibly damaging 0.81
R5757:Lama1 UTSW 17 68,045,782 (GRCm39) missense possibly damaging 0.59
R5795:Lama1 UTSW 17 68,103,722 (GRCm39) missense probably benign 0.02
R5857:Lama1 UTSW 17 68,114,838 (GRCm39) missense probably damaging 0.99
R5894:Lama1 UTSW 17 68,086,042 (GRCm39) critical splice acceptor site probably null
R5974:Lama1 UTSW 17 68,080,722 (GRCm39) missense probably benign 0.31
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6032:Lama1 UTSW 17 68,057,638 (GRCm39) missense probably benign 0.01
R6120:Lama1 UTSW 17 68,087,612 (GRCm39) critical splice donor site probably null
R6219:Lama1 UTSW 17 68,097,851 (GRCm39) missense probably benign 0.08
R6224:Lama1 UTSW 17 68,109,982 (GRCm39) missense possibly damaging 0.56
R6249:Lama1 UTSW 17 68,105,599 (GRCm39) missense probably benign
R6265:Lama1 UTSW 17 68,057,650 (GRCm39) missense probably damaging 0.98
R6276:Lama1 UTSW 17 68,091,083 (GRCm39) splice site probably null
R6284:Lama1 UTSW 17 68,117,091 (GRCm39) missense probably damaging 0.99
R6337:Lama1 UTSW 17 68,093,014 (GRCm39) missense probably benign 0.27
R6414:Lama1 UTSW 17 68,053,905 (GRCm39) critical splice donor site probably null
R6631:Lama1 UTSW 17 68,081,477 (GRCm39) missense probably benign 0.21
R6659:Lama1 UTSW 17 68,125,630 (GRCm39) missense probably damaging 1.00
R6660:Lama1 UTSW 17 68,111,495 (GRCm39) missense probably benign 0.05
R6677:Lama1 UTSW 17 68,102,228 (GRCm39) missense probably benign 0.14
R6763:Lama1 UTSW 17 68,053,868 (GRCm39) missense unknown
R6787:Lama1 UTSW 17 68,091,020 (GRCm39) missense unknown
R6831:Lama1 UTSW 17 68,063,749 (GRCm39) missense possibly damaging 0.89
R6855:Lama1 UTSW 17 68,089,150 (GRCm39) missense possibly damaging 0.95
R6910:Lama1 UTSW 17 68,098,459 (GRCm39) missense possibly damaging 0.60
R6934:Lama1 UTSW 17 68,081,538 (GRCm39) missense probably benign 0.04
R6945:Lama1 UTSW 17 68,120,861 (GRCm39) missense
R6984:Lama1 UTSW 17 68,086,107 (GRCm39) missense
R6989:Lama1 UTSW 17 68,060,753 (GRCm39) missense
R6994:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R6995:Lama1 UTSW 17 68,060,820 (GRCm39) missense
R7035:Lama1 UTSW 17 68,088,044 (GRCm39) missense
R7133:Lama1 UTSW 17 68,089,141 (GRCm39) missense
R7172:Lama1 UTSW 17 68,111,540 (GRCm39) missense
R7197:Lama1 UTSW 17 68,044,700 (GRCm39) nonsense probably null
R7217:Lama1 UTSW 17 68,071,668 (GRCm39) missense
R7229:Lama1 UTSW 17 68,059,441 (GRCm39) missense
R7264:Lama1 UTSW 17 68,050,292 (GRCm39) missense
R7311:Lama1 UTSW 17 68,074,380 (GRCm39) missense
R7394:Lama1 UTSW 17 68,024,256 (GRCm39) missense
R7419:Lama1 UTSW 17 68,024,169 (GRCm39) missense
R7460:Lama1 UTSW 17 68,074,013 (GRCm39) missense
R7492:Lama1 UTSW 17 68,124,646 (GRCm39) missense
R7494:Lama1 UTSW 17 68,118,441 (GRCm39) missense
R7552:Lama1 UTSW 17 68,044,662 (GRCm39) missense
R7576:Lama1 UTSW 17 68,089,036 (GRCm39) missense
R7583:Lama1 UTSW 17 68,068,616 (GRCm39) missense
R7649:Lama1 UTSW 17 68,044,549 (GRCm39) missense
R7663:Lama1 UTSW 17 68,087,875 (GRCm39) missense
R7667:Lama1 UTSW 17 68,087,592 (GRCm39) missense
R7688:Lama1 UTSW 17 68,068,623 (GRCm39) missense
R7693:Lama1 UTSW 17 68,124,026 (GRCm39) missense
R7748:Lama1 UTSW 17 68,057,585 (GRCm39) missense
R7778:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7824:Lama1 UTSW 17 68,111,468 (GRCm39) missense
R7861:Lama1 UTSW 17 68,116,216 (GRCm39) missense
R7884:Lama1 UTSW 17 68,076,430 (GRCm39) missense
R8029:Lama1 UTSW 17 68,124,589 (GRCm39) missense
R8078:Lama1 UTSW 17 68,098,289 (GRCm39) missense
R8101:Lama1 UTSW 17 68,052,917 (GRCm39) missense
R8313:Lama1 UTSW 17 68,057,515 (GRCm39) missense
R8356:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8366:Lama1 UTSW 17 68,125,699 (GRCm39) missense
R8403:Lama1 UTSW 17 68,052,918 (GRCm39) missense
R8456:Lama1 UTSW 17 68,044,491 (GRCm39) missense
R8466:Lama1 UTSW 17 68,120,948 (GRCm39) missense
R8678:Lama1 UTSW 17 68,124,098 (GRCm39) missense
R8728:Lama1 UTSW 17 68,125,663 (GRCm39) missense
R8796:Lama1 UTSW 17 68,117,146 (GRCm39) missense
R8885:Lama1 UTSW 17 68,080,779 (GRCm39) missense
R8893:Lama1 UTSW 17 68,112,367 (GRCm39) missense
R8898:Lama1 UTSW 17 68,128,610 (GRCm39) missense
R8909:Lama1 UTSW 17 68,079,736 (GRCm39) missense
R9045:Lama1 UTSW 17 68,060,838 (GRCm39) missense
R9098:Lama1 UTSW 17 68,111,508 (GRCm39) missense
R9114:Lama1 UTSW 17 68,128,669 (GRCm39) missense
R9173:Lama1 UTSW 17 68,076,597 (GRCm39) missense
R9190:Lama1 UTSW 17 68,111,514 (GRCm39) missense
R9381:Lama1 UTSW 17 68,044,479 (GRCm39) missense
R9429:Lama1 UTSW 17 68,118,449 (GRCm39) missense
R9504:Lama1 UTSW 17 68,128,661 (GRCm39) missense
R9558:Lama1 UTSW 17 68,124,004 (GRCm39) missense
R9647:Lama1 UTSW 17 68,024,170 (GRCm39) missense
R9651:Lama1 UTSW 17 68,101,215 (GRCm39) missense
R9654:Lama1 UTSW 17 68,101,266 (GRCm39) missense
R9710:Lama1 UTSW 17 68,129,404 (GRCm39) missense
R9733:Lama1 UTSW 17 68,116,940 (GRCm39) missense
RF001:Lama1 UTSW 17 68,059,897 (GRCm39) missense
RF013:Lama1 UTSW 17 68,088,057 (GRCm39) missense
V8831:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
X0024:Lama1 UTSW 17 68,045,883 (GRCm39) missense probably damaging 1.00
X0028:Lama1 UTSW 17 68,101,305 (GRCm39) missense probably benign 0.06
X0028:Lama1 UTSW 17 68,074,417 (GRCm39) missense probably benign 0.00
X0066:Lama1 UTSW 17 68,118,561 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,117,166 (GRCm39) missense probably damaging 1.00
Z1088:Lama1 UTSW 17 68,078,077 (GRCm39) missense probably benign 0.25
Z1088:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1176:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1177:Lama1 UTSW 17 68,059,878 (GRCm39) missense probably benign 0.00
Z1191:Lama1 UTSW 17 68,105,639 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTGGTAGAGTTATCACCATACAAG -3'
(R):5'- CACACAAAGGTAGCCAGTGATG -3'

Sequencing Primer
(F):5'- GTTATCACCATACAAGTGGATGAG -3'
(R):5'- CTATTTGATGGTCAGATCTGATTGCC -3'
Posted On 2021-10-11