Incidental Mutation 'R9025:Nedd4l'
ID 686524
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 068854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9025 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65311995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 407 (D407E)
Ref Sequence ENSEMBL: ENSMUSP00000079280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: D407E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: D407E

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: D528E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: D528E

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: D387E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: D407E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G T 6: 128,534,545 (GRCm39) N837K possibly damaging Het
Adam29 A T 8: 56,325,196 (GRCm39) C419* probably null Het
Adamts7 C A 9: 90,067,848 (GRCm39) S446* probably null Het
Ager A G 17: 34,819,594 (GRCm39) R371G probably damaging Het
Apobr T A 7: 126,185,629 (GRCm39) V380E possibly damaging Het
Arhgap26 T C 18: 39,379,898 (GRCm39) S105P Het
Atrip A G 9: 108,902,906 (GRCm39) F56S probably damaging Het
Bag2 T C 1: 33,785,905 (GRCm39) Y139C Het
Bccip C T 7: 133,319,346 (GRCm39) Q146* probably null Het
Btbd10 G A 7: 112,951,031 (GRCm39) R20W possibly damaging Het
Catsperd T A 17: 56,962,156 (GRCm39) N443K probably damaging Het
Cdh26 G A 2: 178,104,409 (GRCm39) E265K probably benign Het
Cep76 T C 18: 67,767,885 (GRCm39) R216G probably damaging Het
Cgas C A 9: 78,349,787 (GRCm39) V192L probably benign Het
Cnot1 T A 8: 96,475,660 (GRCm39) M1000L probably benign Het
Cyp1a1 A G 9: 57,610,070 (GRCm39) T495A possibly damaging Het
Cyp2w1 T A 5: 139,342,470 (GRCm39) M421K probably benign Het
Dlg5 T C 14: 24,199,546 (GRCm39) T1453A probably benign Het
Dnah5 G T 15: 28,409,412 (GRCm39) W3610L probably damaging Het
Dnah9 T C 11: 65,896,651 (GRCm39) D2391G probably damaging Het
Dnajc10 G A 2: 80,179,637 (GRCm39) G724R probably damaging Het
Dst T A 1: 34,227,585 (GRCm39) I1726N possibly damaging Het
Dync2h1 A T 9: 7,139,462 (GRCm39) L1391* probably null Het
Dzank1 T C 2: 144,318,012 (GRCm39) S718G probably benign Het
E230025N22Rik T C 18: 36,819,890 (GRCm39) D300G probably damaging Het
Ebf3 T C 7: 136,914,098 (GRCm39) I131V possibly damaging Het
Eif3g T C 9: 20,807,426 (GRCm39) I131V probably benign Het
Eppk1 T A 15: 75,990,503 (GRCm39) Q2126L possibly damaging Het
Fam83h T C 15: 75,874,182 (GRCm39) R1052G probably benign Het
Fry A T 5: 150,219,273 (GRCm39) probably benign Het
Ggt6 C T 11: 72,328,123 (GRCm39) H208Y possibly damaging Het
Gm15821 T A 17: 34,433,235 (GRCm39) E28V unknown Het
Gprin2 T C 14: 33,916,957 (GRCm39) Q271R probably damaging Het
Gsdmd T C 15: 75,739,053 (GRCm39) F477L probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hmcn2 A G 2: 31,347,967 (GRCm39) H4871R possibly damaging Het
Il15ra G A 2: 11,723,233 (GRCm39) V86I possibly damaging Het
Il17rb C A 14: 29,724,857 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnab2 T C 4: 152,491,635 (GRCm39) Y63C probably damaging Het
Kctd17 A T 15: 78,314,282 (GRCm39) Y84F probably damaging Het
Lama1 T A 17: 68,119,491 (GRCm39) V2656E Het
Lama2 T C 10: 26,860,367 (GRCm39) N3040S probably benign Het
Ldha C T 7: 46,500,433 (GRCm39) R173C unknown Het
Lig1 A G 7: 13,037,746 (GRCm39) I665M probably damaging Het
Lipe G A 7: 25,083,923 (GRCm39) A412V probably damaging Het
Lrrc63 T C 14: 75,322,284 (GRCm39) T607A probably benign Het
Majin G A 19: 6,263,427 (GRCm39) probably null Het
Map3k19 A G 1: 127,758,175 (GRCm39) L335P probably benign Het
Map3k9 A G 12: 81,819,507 (GRCm39) L249P probably damaging Het
Muc5b G T 7: 141,426,209 (GRCm39) D4769Y probably damaging Het
Myh9 T C 15: 77,653,192 (GRCm39) T1382A probably benign Het
Ngp A G 9: 110,251,451 (GRCm39) I160V possibly damaging Het
Nmrk1 A G 19: 18,617,156 (GRCm39) probably benign Het
Nnmt C A 9: 48,503,461 (GRCm39) K188N probably damaging Het
Nup153 T A 13: 46,837,709 (GRCm39) Q1171L probably benign Het
Oplah T A 15: 76,187,417 (GRCm39) E556V probably benign Het
Or9g3 T G 2: 85,589,879 (GRCm39) L280F possibly damaging Het
Otog A G 7: 45,937,520 (GRCm39) D1743G probably benign Het
Otogl T C 10: 107,613,432 (GRCm39) Y2011C probably damaging Het
Pbx4 C T 8: 70,317,097 (GRCm39) P118L probably benign Het
Plekha6 T A 1: 133,212,999 (GRCm39) S757T probably benign Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Polr3a C T 14: 24,519,479 (GRCm39) S643N probably damaging Het
Pwp1 T A 10: 85,718,745 (GRCm39) L304Q probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rab11fip1 A G 8: 27,644,736 (GRCm39) F350L probably benign Het
Safb2 T C 17: 56,873,614 (GRCm39) E683G probably damaging Het
Scarb1 A T 5: 125,381,414 (GRCm39) N43K probably damaging Het
Serpina3k A G 12: 104,307,230 (GRCm39) E154G probably damaging Het
Sgsm3 T A 15: 80,892,182 (GRCm39) V250D probably damaging Het
Slit1 T A 19: 41,612,968 (GRCm39) I851F probably benign Het
Spag4 G A 2: 155,910,424 (GRCm39) G350E probably damaging Het
Sult2a7 A T 7: 14,225,755 (GRCm39) L77Q probably damaging Het
Tbc1d2 T A 4: 46,607,062 (GRCm39) T783S probably damaging Het
Thoc6 T C 17: 23,888,862 (GRCm39) E182G Het
Tmem132a A T 19: 10,837,525 (GRCm39) I595N probably damaging Het
Trim69 A G 2: 122,003,771 (GRCm39) N240S probably benign Het
Ush1c A T 7: 45,846,614 (GRCm39) probably benign Het
Wnk4 T G 11: 101,153,641 (GRCm39) Y234* probably null Het
Zfp943 A G 17: 22,211,321 (GRCm39) N136D possibly damaging Het
Znhit2 G A 19: 6,111,669 (GRCm39) R138H possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65,341,574 (GRCm39) splice site probably benign
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAACAGTTAACCTCCCATCGG -3'
(R):5'- TGGCGTCTCACCCTTCTAAG -3'

Sequencing Primer
(F):5'- TCCCATCGGAGGCCTGTTC -3'
(R):5'- TTGACCAATGGACCCAGAAAG -3'
Posted On 2021-10-11