Mutagenetix > Incidental Mutation

Incidental Mutation 'R8771:Trip12'

686532

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8771 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 84743297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably benign
Transcript: ENSMUST00000027421

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186465

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186648

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189670

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	T	C	18: 59,066,980		probably benign	Het
Abca4	T	C	3: 122,086,671	I451T	probably damaging	Het
Acin1	T	C	14: 54,643,039	K1236E	unknown	Het
AI661453	T	C	17: 47,466,758	S470P	unknown	Het
Ano5	C	A	7: 51,566,347	N357K	probably damaging	Het
Ano5	C	T	7: 51,570,299	Q396*	probably null	Het
Baz1b	T	A	5: 135,244,297	M1425K	probably benign	Het
Cdh22	A	T	2: 165,146,769	V222E	possibly damaging	Het
Celsr1	A	T	15: 85,903,974	S2692R	probably benign	Het
Ces5a	A	G	8: 93,528,621	I144T	possibly damaging	Het
D5Ertd579e	T	A	5: 36,604,596	N1309I	probably damaging	Het
Dnmt3b	C	T	2: 153,662,814	T112M	possibly damaging	Het
Eif4g3	C	T	4: 138,180,537	Q1283*	probably null	Het
Etnppl	T	A	3: 130,620,375	M41K	probably damaging	Het
Hhatl	G	A	9: 121,788,710	T271I	possibly damaging	Het
Igkv5-37	A	G	6: 69,963,439	S74P	probably damaging	Het
Krt83	A	G	15: 101,487,898	V272A	probably benign	Het
Lgr6	A	T	1: 135,005,691	L262*	probably null	Het
Lrriq3	G	A	3: 155,193,633	V590I	probably damaging	Het
Mfsd13a	T	C	19: 46,372,229	V382A	probably damaging	Het
Mrc2	A	G	11: 105,349,770	T1429A	probably benign	Het
Mroh5	A	T	15: 73,821,354	M79K	possibly damaging	Het
Myo1c	A	G	11: 75,665,883	K553R	probably benign	Het
Nbeal1	A	G	1: 60,261,584	T1488A	probably benign	Het
Olfr1022	T	G	2: 85,869,368	Y259D	probably damaging	Het
Olfr1109	T	C	2: 87,092,950	Y149C	probably benign	Het
Olfr1259	T	C	2: 89,943,221	K298R	probably benign	Het
Olfr502	T	A	7: 108,523,425	N175I	possibly damaging	Het
Prl7a1	A	T	13: 27,635,828	W148R	probably damaging	Het
Ptpn2	G	T	18: 67,672,589	T402K	probably benign	Het
Ptprf	A	G	4: 118,211,790	M1665T	possibly damaging	Het
Raet1e	G	T	10: 22,181,142	V122F	probably damaging	Het
Serpina3m	A	G	12: 104,391,582	E255G	probably damaging	Het
Sorcs2	T	C	5: 36,031,280	Y828C	probably damaging	Het
Sprr1a	T	A	3: 92,484,682	H4L	probably benign	Het
Sptssa	A	G	12: 54,656,426	Y20H	probably damaging	Het
Synpo2l	A	G	14: 20,660,423	S939P	probably damaging	Het
Tdrd7	T	C	4: 46,010,800	V568A	probably damaging	Het
Tmem132c	C	T	5: 127,360,128	P227L	probably benign	Het
Tmtc3	A	G	10: 100,450,318	S548P	possibly damaging	Het
Ttll6	A	G	11: 96,151,936	Y436C	probably damaging	Het
Unc80	A	G	1: 66,646,395	D2226G	possibly damaging	Het
Vmn1r142	T	C	7: 22,163,312	M242V	probably benign	Het
Vmn2r12	T	G	5: 109,092,086	T204P	possibly damaging	Het
Vmn2r16	C	T	5: 109,340,365	T368M	probably benign	Het
Vmn2r61	C	A	7: 42,266,770	A269D	probably damaging	Het
Zfp148	A	G	16: 33,497,286	D776G	possibly damaging	Het
Zfp775	A	T	6: 48,619,972	Q260L	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATGACAGTCAGCTTCCCTC -3'
(R):5'- AGGCTGCCTTTAGTGTCTTAC -3'

Sequencing Primer
(F):5'- GACAGTCAGCTTCCCTCAATGTATC -3'
(R):5'- AGTCTTCCTGAGAAGACTT -3'

Posted On

2021-10-13