Incidental Mutation 'R9019:Pdzd2'
ID686631
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene NamePDZ domain containing 2
SynonymsPdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R9019 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location12359711-12739924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12375526 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1508 (Y1508H)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: Y1508H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: Y1508H

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,120,696 T1174S Het
Aoc2 C T 11: 101,325,436 P115L possibly damaging Het
Arhgef19 C T 4: 141,246,427 P75L probably benign Het
Atad3a A G 4: 155,753,595 V240A possibly damaging Het
AW551984 A T 9: 39,597,677 L317* probably null Het
Bdkrb1 T C 12: 105,604,441 S89P probably damaging Het
Bpifb4 T A 2: 153,948,687 L166* probably null Het
Ccdc27 A G 4: 154,039,557 V173A unknown Het
Ccl8 T C 11: 82,116,051 V30A probably benign Het
Cdc16 C T 8: 13,781,501 A578V probably benign Het
Cnksr1 T C 4: 134,232,054 Y423C probably damaging Het
Cyp3a44 T C 5: 145,790,709 D270G probably damaging Het
Ep300 A G 15: 81,648,529 E1656G unknown Het
Eppk1 A G 15: 76,108,272 F1470L probably benign Het
Fbxw16 T A 9: 109,441,067 D202V probably damaging Het
Fndc3a G A 14: 72,574,400 T330I probably benign Het
Gm36864 A T 7: 44,237,604 Q307L probably benign Het
Gm37240 T C 3: 84,519,639 E38G probably damaging Het
Gm6871 A T 7: 41,545,838 C492S probably damaging Het
Gnaq T C 19: 16,378,274 Y285H probably benign Het
Htt T A 5: 34,866,576 F1723I probably damaging Het
Il21r G A 7: 125,632,300 S300N probably damaging Het
Itm2b G A 14: 73,368,416 probably benign Het
Kat6a T C 8: 22,935,738 S1100P probably damaging Het
Kcnj2 T C 11: 111,072,589 I269T probably damaging Het
Kmt2c G A 5: 25,283,210 A4635V probably damaging Het
Kng2 A T 16: 23,028,796 D38E probably damaging Het
Lgr5 A C 10: 115,478,549 L161R probably damaging Het
Lrig2 A T 3: 104,461,598 I923N probably benign Het
Mrgprh T C 17: 12,877,313 S147P probably damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nsmaf A T 4: 6,418,523 S427R probably damaging Het
Olfr968 G T 9: 39,772,742 D19E probably benign Het
Pdcd11 G T 19: 47,113,219 G948C probably damaging Het
Prmt5 G T 14: 54,516,107 A105E probably benign Het
Prr23a3 T C 9: 98,865,160 S56P probably damaging Het
Slc44a2 A G 9: 21,353,781 E705G probably damaging Het
Sostdc1 A T 12: 36,314,432 N47Y probably benign Het
Speg T C 1: 75,429,238 Y3029H probably damaging Het
Srd5a1 G A 13: 69,600,294 R129* probably null Het
Srgap1 CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC CTACCTCCTCTTAGGGACCACGCCCACCCCCTCCCAGGGACCATGCTTACCTCCTC 10: 121,853,553 probably benign Het
Srrm4 A G 5: 116,467,527 S224P unknown Het
Syne2 A G 12: 75,952,844 E2337G possibly damaging Het
Tmem150c C A 5: 100,093,099 V32L probably benign Het
Topaz1 T C 9: 122,790,127 I1263T possibly damaging Het
Ttc39d C T 17: 80,215,920 R3W probably benign Het
Xylt1 T C 7: 117,650,811 probably null Het
Zfp933 A T 4: 147,826,564 C192S probably damaging Het
Zswim8 G A 14: 20,711,051 G129D probably damaging Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
R8768:Pdzd2 UTSW 15 12437166 missense probably damaging 1.00
R8879:Pdzd2 UTSW 15 12402319 missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12374299 missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12374667 missense possibly damaging 0.94
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGAAGCAGGCTTTCTCG -3'
(R):5'- TTTGAGAGTCAGCCACCAGG -3'

Sequencing Primer
(F):5'- TCTGCTGTACCGAGGGAACTG -3'
(R):5'- TGGCAGTTCCCACCATGG -3'
Posted On2021-11-19