Incidental Mutation 'R9020:Cfap65'
ID 686640
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock # R9020 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74920393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 866 (E866G)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: E866G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: E866G

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Meta Mutation Damage Score 0.3343 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,748,418 S586P probably damaging Het
Adora3 T A 3: 105,907,825 I297N probably damaging Het
Adrb3 A T 8: 27,227,919 F167L probably damaging Het
Apob A G 12: 8,013,999 Y3955C probably damaging Het
Atp2a1 T C 7: 126,446,963 D963G probably benign Het
Btbd10 T C 7: 113,351,850 N11S possibly damaging Het
Casr A G 16: 36,495,249 S820P probably damaging Het
Ccdc82 C T 9: 13,281,425 R447C probably damaging Het
Cfap44 T A 16: 44,437,159 V1019E probably damaging Het
Chd4 T A 6: 125,107,506 D713E probably damaging Het
Ctdsp1 T C 1: 74,395,517 F240S possibly damaging Het
Cyp26b1 C T 6: 84,575,074 V361I probably benign Het
Dmbt1 T A 7: 131,111,058 I1597N possibly damaging Het
Dnajc25 C A 4: 59,003,470 Y80* probably null Het
Fbxo17 A T 7: 28,737,357 N246Y possibly damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Gm9758 A C 5: 14,914,725 N35K Het
Gtf2i T C 5: 134,246,561 T707A probably benign Het
Ifnk T C 4: 35,152,573 V167A probably damaging Het
Iqch T C 9: 63,525,244 M290V probably benign Het
Irx1 A T 13: 71,963,429 Y20* probably null Het
Jade2 T A 11: 51,817,627 Q572L probably benign Het
Kcne4 T A 1: 78,817,708 H24Q probably benign Het
Kcnq5 T C 1: 21,469,239 probably benign Het
Kcnt2 T A 1: 140,584,311 V1068E probably benign Het
Klk1b27 T A 7: 44,055,694 V95D probably damaging Het
Lins1 A G 7: 66,708,213 D32G probably damaging Het
Mavs A G 2: 131,246,674 E466G possibly damaging Het
Mipep T A 14: 60,831,228 L483* probably null Het
Muc16 G GAATGGCTTTCTT 9: 18,638,719 probably benign Het
Myo1a C A 10: 127,714,123 Q491K probably benign Het
Nle1 C G 11: 82,906,449 E146Q probably benign Het
Nphp3 T C 9: 104,031,951 Y787H probably benign Het
Pcdh15 A G 10: 74,645,611 S263G probably benign Het
Pcdhb8 T G 18: 37,356,784 I505S probably damaging Het
Phtf1 C G 3: 103,991,378 S339* probably null Het
Pip5k1b T A 19: 24,350,221 I424F probably benign Het
Plxna4 T A 6: 32,234,562 T681S possibly damaging Het
Prdm1 A G 10: 44,440,040 L700P probably damaging Het
Prtg C T 9: 72,891,995 T769I probably damaging Het
Rasgrf2 A G 13: 92,028,638 V340A possibly damaging Het
Ros1 T A 10: 52,154,927 E548D probably benign Het
Rsph10b G A 5: 143,985,465 R823Q probably benign Het
Scgb1b3 A G 7: 31,375,851 E42G probably damaging Het
Scyl2 T C 10: 89,652,996 N486D probably damaging Het
Sdr9c7 T A 10: 127,909,790 I257N possibly damaging Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Slc15a5 T A 6: 138,055,706 I217F probably benign Het
Steap2 T C 5: 5,673,480 S467G probably benign Het
Sycp1 T C 3: 102,876,337 K607R probably benign Het
Tek C G 4: 94,820,102 P350R probably benign Het
Tet3 T C 6: 83,404,436 D250G probably damaging Het
Trip11 A G 12: 101,884,511 V1098A possibly damaging Het
Tsc2 G T 17: 24,626,717 T209K probably damaging Het
Ttc6 A G 12: 57,705,580 Y1424C probably damaging Het
Uchl3 A T 14: 101,666,550 K74N probably damaging Het
Usp10 T G 8: 119,941,165 S68R probably benign Het
Wwp1 T C 4: 19,650,282 I295V probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCAATTTCCTGTAAGTTGTG -3'
(R):5'- CTCAGGAAGTGAGCATGCAG -3'

Sequencing Primer
(F):5'- CAATTTCCTGTAAGTTGTGGGTAAG -3'
(R):5'- TGGATCTGAAGCTGGACACC -3'
Posted On 2021-11-19